Class 12 · Molecular Basis of Inheritance

Coding vs Template Strand — NEET Biology

✅ Asked in NEET 2023
✅ NEET 2023 PYQ · Asked 3 times

If the sequence on mRNA formed is 5’-AUCGAUCGAUCGAUCGAUCGAUCGAUCG-3’, what is the sequence on the corresponding coding strand? (NEET 2023)

Q1 of 3NEET 2023

If the sequence on mRNA formed is 5’-AUCGAUCGAUCGAUCGAUCGAUCGAUCG-3’, what is the sequence on the corresponding coding strand? (NEET 2023)

Q2 of 3NEET 2018

AGGTATCGCAT is a sequence from coding strand. What will be the transcribed mRNA? (NEET 2018)

Q3 of 3NEET 2016

DNA-dependent RNA polymerase transcribes which strand? (NEET 2016 Phase 2)

Answer & NCERT explanation

Correct answer: C 5’ ATCGATCGATCGATCGATCGATCGATCG 3’

The coding strand has the same sequence as mRNA except T instead of U. Given mRNA: 5'-AUCGAUCGAUCGAUCGAUCGAUCGAUCG-3', the coding strand will be: 5'-ATCGATCGATCGATCGATCGATCGATCG-3'. The coding strand runs parallel to mRNA (both 5' to 3') and has identical sequence except T replaces U. Template strand would be complementary and antiparallel.

Read more NCERT concept on the PYQ

📖 NCERT Source

There is a convention in defining the two strands of the DNA in the structural gene of a transcription unit. Since the two strands have opposite polarity and the DNA-dependent RNA polymerase also catalyse the polymerisation in only one direction, that is, 5'→3', the strand that has the polarity 3'→5' acts as a template, and is also referred to as template strand. The other strand which has the polarity (5'→3') and the sequence same as RNA (except thymine at the place of uracil), is displaced during transcription. Strangely, this strand (which does not code for anything) is referred to as coding strand. All the reference point while defining a transcription unit is made with coding strand. To explain the point, a hypothetical sequence from a transcription unit is represented below:

NCERT Biology · Class 12 · Chapter 5 · Paragraph 73
How NTA Uses This Concept

The coding strand is NOT the template for mRNA synthesis; the template strand (3'→5') is used by RNA polymerase. The coding strand has the same sequence as mRNA (except T replaces U), which confuses students. Students often mistake the coding strand as the one doing transcription, but it actually sits idle. NTA tests this by asking which strand serves as template, or which has the same sequence as mRNA. Remember: template strand = antisense strand (3'→5'), coding strand = sense strand (5'→3', same as mRNA). This concept appears repeatedly because understanding DNA directionality and transcription mechanics is fundamental to molecular biology.

❓ Frequently Asked Questions
What does NCERT say about There convention defining two?
There is a convention in defining the two strands of the DNA in the structural gene of a transcription unit. Since the two strands have opposite polarity and the DNA-dependent RNA polymerase also catalyse the polymerisation in only one direction, that is, 5'→3', the strand that has the polarity 3'→5' acts as a template, and is also referred to as template strand.
Has this concept appeared in NEET?
Yes — appeared in NEET 2023, 2018, 2016. Defines coding strand has same sequence as RNA except T instead of U
Which chapter is this from?
Molecular Basis of Inheritance, Class 12 NCERT Biology.

Through deep analysis of NEET and NTA, 176 of the 180 ReNEET 2026 (June 21) questions were already in the MedicNEET question bank before the exam.

176/180
of the ReNEET 2026 paper (all subjects) was already in the MedicNEET question bank

MedicNEET's Biology question bank is built from the same NCERT lines NTA picks repeatedly. Not random MCQs — questions crafted exactly like NTA crafts them.

176 of 180 ReNEET 2026 questions traced to MedicNEET17,000+ Biology questionsHindi + English
Free to start · Hindi + English · 43,000+ questions · NEET 2026 pattern
Related Concepts from Molecular Basis of Inheritance
📘Practice all 84 NEET PYQs from Molecular Basis of Inheritance