If the sequence on mRNA formed is 5’-AUCGAUCGAUCGAUCGAUCGAUCGAUCG-3’, what is the sequence on the corresponding coding strand? (NEET 2023)
AGGTATCGCAT is a sequence from coding strand. What will be the transcribed mRNA? (NEET 2018)
DNA-dependent RNA polymerase transcribes which strand? (NEET 2016 Phase 2)
Correct answer: C — 5’ ATCGATCGATCGATCGATCGATCGATCG 3’
The coding strand has the same sequence as mRNA except T instead of U. Given mRNA: 5'-AUCGAUCGAUCGAUCGAUCGAUCGAUCG-3', the coding strand will be: 5'-ATCGATCGATCGATCGATCGATCGATCG-3'. The coding strand runs parallel to mRNA (both 5' to 3') and has identical sequence except T replaces U. Template strand would be complementary and antiparallel.
There is a convention in defining the two strands of the DNA in the structural gene of a transcription unit. Since the two strands have opposite polarity and the DNA-dependent RNA polymerase also catalyse the polymerisation in only one direction, that is, 5'→3', the strand that has the polarity 3'→5' acts as a template, and is also referred to as template strand. The other strand which has the polarity (5'→3') and the sequence same as RNA (except thymine at the place of uracil), is displaced during transcription. Strangely, this strand (which does not code for anything) is referred to as coding strand. All the reference point while defining a transcription unit is made with coding strand. To explain the point, a hypothetical sequence from a transcription unit is represented below:
The coding strand is NOT the template for mRNA synthesis; the template strand (3'→5') is used by RNA polymerase. The coding strand has the same sequence as mRNA (except T replaces U), which confuses students. Students often mistake the coding strand as the one doing transcription, but it actually sits idle. NTA tests this by asking which strand serves as template, or which has the same sequence as mRNA. Remember: template strand = antisense strand (3'→5'), coding strand = sense strand (5'→3', same as mRNA). This concept appears repeatedly because understanding DNA directionality and transcription mechanics is fundamental to molecular biology.
MedicNEET's Biology question bank is built from the same NCERT lines NTA picks repeatedly. Not random MCQs — questions crafted exactly like NTA crafts them.