Class 12 · Molecular Basis of Inheritance

Transcription: Copying DNA to RNA — NEET Biology

✅ Asked in NEET 2024
✅ NEET 2024 PYQ · Asked 2 times

Which one is the correct product of DNA dependent RNA polymerase to the given template? Template strand: 3′TACATGGCAAATATCCATTCA5′

Q1 of 2NEET 2024

Which one is the correct product of DNA dependent RNA polymerase to the given template? Template strand: 3′TACATGGCAAATATCCATTCA5′

Q2 of 2NEET 2023

Given below are two statements: (NEET 2023) I: The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. II: A transcription unit in DNA is defined primarily by the three regions in the DNA i.e. a promoter, the structural gene, and a terminator. Choose the correct answer:

Answer & NCERT explanation

Correct answer: A 5′AUGUACCGUUUAUAGGUAAGU3′

RNA polymerase reads the template strand 3' to 5' and synthesizes RNA 5' to 3'. Given template: 3'TACATGGCAAATATCCATTCA5', the complementary RNA will be: 5'AUGUACCGUUUAUAGGUAAGU3'. Note that T in DNA becomes A in RNA, A becomes U, G becomes C, and C becomes G. The RNA is antiparallel to the template strand.

Read more NCERT concept on the PYQ

📖 NCERT Source

The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Here also, the principle of complementarity governs the process of transcription, except the adenosine complements now forms base pair with uracil instead of thymine. However, unlike in the process of replication, which once set in, the total DNA of an organism gets duplicated, in transcription only a segment of DNA and only one of the strands is copied into RNA. This necessitates defining the boundaries that would demarcate the region and the strand of DNA that would be transcribed.

📐See NCERT Figure 5.8 for the diagram.
NCERT Biology · Class 12 · Chapter 5 · Paragraph 70
How NTA Uses This Concept

Transcription is the process where only one DNA strand is selectively copied into RNA following complementarity rules, with adenine pairing with uracil instead of thymine. NTA tests whether students understand that transcription differs from replication: replication duplicates the entire DNA, while transcription copies only a specific DNA segment and only one strand. Students often confuse which base adenine pairs with during transcription (thymine vs. uracil) or mistakenly think all DNA is transcribed. Remember: transcription is selective, strand-specific, uses uracil in RNA, and requires defined boundaries (promoter and terminator sequences) to mark the transcribable region.

❓ Frequently Asked Questions
What does NCERT say about process copying genetic information?
The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Here also, the principle of complementarity governs the process of transcription, except the adenosine complements now forms base pair with uracil instead of thymine.
Has this concept appeared in NEET?
Yes — appeared in NEET 2024, 2023. Describes transcription using complementarity principle
Which chapter is this from?
Molecular Basis of Inheritance, Class 12 NCERT Biology.

Through deep analysis of NEET and NTA, 176 of the 180 ReNEET 2026 (June 21) questions were already in the MedicNEET question bank before the exam.

176/180
of the ReNEET 2026 paper (all subjects) was already in the MedicNEET question bank

MedicNEET's Biology question bank is built from the same NCERT lines NTA picks repeatedly. Not random MCQs — questions crafted exactly like NTA crafts them.

176 of 180 ReNEET 2026 questions traced to MedicNEET17,000+ Biology questionsHindi + English
Free to start · Hindi + English · 43,000+ questions · NEET 2026 pattern
Related Concepts from Molecular Basis of Inheritance
📘Practice all 84 NEET PYQs from Molecular Basis of Inheritance