Transcription: Copying DNA to RNA — NEET Biology
✅ Asked in NEET 2024The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Here also, the principle of complementarity governs the process of transcription, except the adenosine complements now forms base pair with uracil instead of thymine. However, unlike in the process of replication, which once set in, the total DNA of an organism gets duplicated, in transcription only a segment of DNA and only one of the strands is copied into RNA. This necessitates defining the boundaries that would demarcate the region and the strand of DNA that would be transcribed.
Transcription is the process where only one DNA strand is selectively copied into RNA following complementarity rules, with adenine pairing with uracil instead of thymine. NTA tests whether students understand that transcription differs from replication: replication duplicates the entire DNA, while transcription copies only a specific DNA segment and only one strand. Students often confuse which base adenine pairs with during transcription (thymine vs. uracil) or mistakenly think all DNA is transcribed. Remember: transcription is selective, strand-specific, uses uracil in RNA, and requires defined boundaries (promoter and terminator sequences) to mark the transcribable region.
This paragraph was tested 2 times in NEET.
Which one is the correct product of DNA dependent RNA polymerase to the given template? Template strand: 3′TACATGGCAAATATCCATTCA5′
Given below are two statements: (NEET 2023) I: The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. II: A transcription unit in DNA is defined primarily by the three regions in the DNA i.e. a promoter, the structural gene, and a terminator. Choose the correct answer:
Through deep analysis of NEET and NTA, 88 of 90 questions from the NEET 2026 paper were matched straight from the MedicNEET Biology question bank.
88/90MedicNEET's Biology question bank is built from the same NCERT lines NTA picks repeatedly. Not random MCQs — questions crafted exactly like NTA crafts them.