Year-wise Weightage (2015–2026)

2026 vs 2025: 3 fewer questions vs 2025

YearQuestions AskedMarks
2026728
20251040
2024624
20231664
2022624
Show all years (2015–2021)
2021832
2020416
20191456
2018520
2017728
20161248
2015
Q1
NEET 2016 Phase 2

Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria?

Q2
NEET 2016 Phase 1 · NEET 2019 Odisha · ReNEET 2026

Which of the following statements about the lac-operon is correct?

Q3
NEET 2016 Phase 1

The correct statement regarding RNA and DNA, respectively is:

Q4
NEET 2016 Phase 1

Which one of the following is the starter codon?

Q5
NEET 2016 Phase 2

A molecule that can act as a genetic material must fulfill the traits given below, except

Q6
NEET 2016 Phase 1 · NEET 2016 Phase 2

Which one of the following statements about Histones is wrong?

Q7
NEET 2016 Phase 1

Which of the following is not required for any of the techniques of DNA fingerprinting available at present?

Q8
NEET 2016 Phase 2

The equivalent of a structural gene is

Q9
NEET 2016 Phase 2

DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the

Q10
NEET 2016 Phase 1

A complex of ribosomes attached to single strand of RNA is known as:

Q11
NEET 2016 Phase 2

Taylor conducted the experiments to prove semiconservative mode of chromosome replication on

Q12
NEET 2016 Phase 1

Which of the following is required as inducer(s) for the expression of Lac operon?

Q13
NEET 2017

Which of the following RNAs should be most abundant in animal cell?

Q14
NEET 2017

During DNA replication, Okazaki fragments are used to elongate

Q15
NEET 2017

A particular mRNA, in a hypothetical case, codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered?

Q16
NEET 2017

DNA replication in bacteria occurs

Q17
NEET 2017

The association of histone H1 with a nucleosome indicates:

Q18
NEET 2017

Spliceosomes are not found in cells of

Q19
NEET 2017

The final proof for DNA as the genetic material came from the experiments of

Q20
NEET 2018

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as

Q21
NEET 2018

AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?

Q22
NEET 2018

The experimental proof for semiconservative replication of DNA was first shown in a

Q23
NEET 2018

Select the correct match. a. Matthew Meselson and F. Stahl - Pisum sativum b. Alfred Hershey and Martha Chase - TMV c. Alec Jeffreys - Streptococcus pneumoniae d. Francois Jacob and Jacques Monod - Lac operon

Q24
NEET 2018

All of the following are part of an operon except

Q25
NEET 2019 Odisha

Match the following RNA polymerase with their transcribed products : Column I (a) RNA polymerase I (b) RNA polymerase II (c) RNA polymerase III Column II (i) tRNA (ii) rRNA (iii) hnRNA Select the correct option from the following

Q26
NEET 2019 Odisha

From the following, identify the correct combination of salient features of Genetic Code

Q27
NEET 2019

Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?

Q28
NEET 2019

Under which of the following conditions will there be no change in the reading frame of following mRNA? 5'AACAGCGGUGCUAUU3'

Q29
NEET 2019 Odisha

Which scientist experimentally proved that DNA is the sole genetic material in bacteriophage ?

Q30
NEET 2019 Odisha

What will be the sequence of mRNA produced by the following stretch of DNA ? 3'ATGCATGCATGCATG5' TEMPLATE STRAND 5'TACGTACGTACGTAC3' CODING STRAND

Q31
NEET 2019

Purines found both in DNA and RNA are

Q32
NEET 2019 Odisha

Which of the following nucleic acids is present in an organism having 70S ribosomes only ?

Q33
NEET 2019 · NEET 2023 Phase 1

Expressed Sequence Tags (ESTs) refers to :

Q34
NEET 2019 · NEET 2023 Phase 1

Expressed Sequence Tags (ESTs) refers to

Q35
NEET 2019 Odisha

What initiation and termination factors are involved in transcription in Eukaryotes ?

Q36
NEET 2019 Odisha

In the process of transcription in Eukaryotes, the RNA polymerase I transcribes :-

Q37
NEET 2019

Match the following genes of the Lac operon with their respective products : Column-I (a) i gene (b) z gene (c) a gene (d) y gene Column-II (i) β-galactosidase (ii) Permease (iii) Repressor (iv) Transacetylase Select the correct option.

Q38
NEET 2020

If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 X 10^9 bp, then the length of the DNA is approximately

Q39
NEET 2020

Which of the following statements is correct? a. Adenine pairs with thymine through three H-bonds b. Adenine does not pair with thymine c. Adenine pairs with thymine through two H-bonds d. Adenine pairs with thymine through one H-bond

Q40
NEET 2020

The first phase of translation is:

Q41
NEET 2020

Name the enzyme that facilitates opening of DNA helix during transcription.

Q42
NEET 2021 · NEET 2023 Phase 1

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

Q43
NEET 2021

Which is the “Only enzyme” that has “Capability” to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?

Q44
NEET 2021

Complete the flow chart on central dogma. (a) ____ (b) ____ (c) ____ (d) ____ (The flow chart shows DNA, with a self-directed arrow (a) back to DNA, an arrow (b) from DNA to RNA, an arrow (c) from RNA to (d).) a. (a)-Replication; (b)-Transcription; (c)-Translation; (d)-Protein b. (a)-Transduction; (b)-Translation; (c)-Replication; (d)-Protein c. (a)-Replication; (b)-Transcription; (c)-Transduction; (d)-Protein d. (a)-Translation; (b)-Replication; (c)-Transcription; (d)-Transduction

Q45
NEET 2021

If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

Q46
NEET 2021

Identify the correct statement. a. The coding strand in a transcription unit is copied to an mRNA b. Split gene arrangement is characteristic of prokaryotes c. In capping, methyl guanosine triphosphate is added to the 3’ end of hnRNA. d. RNA polymerase binds with Rho factor to terminate the process of transcription in bacteria.

Q47
NEET 2021

DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as:

Q48
NEET 2021 · NEET 2023 Phase 1

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Q49
NEET 2021

Which of the following RNAs is not required for the synthesis of protein?

Q50
NEET 2022

The process of translation of mRNA to proteins begins as soon as:

Q51
NEET 2022

Ten E. coli cells with 15N- dsDNA are incubated in a medium containing 14N nucleotides. After 60 minutes, how many E. coli cells will have DNA totally free from 15N?

Q52
NEET 2022

If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?

Q53
NEET 2022

DNA polymorphism forms the basis of:

Q54
NEET 2022

If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of functions to different segment, the methodology adopted by him is called as:

Q55
NEET 2022

In an E. coli strain the i gene gets mutated and its product can not bind the inducer molecule. If the growth medium is provided with lactose, what will be the outcome?

Q56
NEET 2023 Phase 2

The last chromosome sequenced in Human Genome Project was :

Q57
NEET 2023 Phase 2

Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.

Q58
NEET 2023 Phase 1

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

Q59
NEET 2023 Phase 1

Given below are two statements: Statement I: The codon 'AUG' codes for methionine and phenylalanine. Statement II: 'AAA' and 'AAG' both codons code for the amino acid lysine. In the light of the above statements, choose the correct answer from the options given below:

Q60
NEET 2023 Phase 1

Among eukaryotes, replication of DNA takes place in

Q61
NEET 2023 Phase 1

Unequivocal proof that DNA is the genetic material was first proposed by

Q62
NEET 2023 Phase 2

Which scientist conducted an experiment with 32P and 35S labelled phages for demonstrating that DNA is the genetic material?

Q63
NEET 2023 Phase 1

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?

Q64
NEET 2023 Phase 2

Given below are two statements : Statement I : The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Statement II : A transcription unit in DNA is defined primarily by the three regions in the DNA, i.e., a promotor, the structural gene and a terminator. In the light of the above statements, choose the correct answer from the options given below :

Q65
NEET 2023 Phase 2

Given below are two statements: Statement I: RNA being unstable, mutate at a faster rate. Statement II: RNA can directly code for synthesis of proteins, hence can easily express the characters. In the light of the above statements, choose the correct answer from the options given below:

Q66
NEET 2023 Phase 1

How many different proteins does the ribosome consist of?

Q67
NEET 2023 Phase 2

The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific (D) The code is nearly universal Choose the most appropriate answer from the options given below :

Q68
NEET 2024

Match List I with List II. List I: A. Frederick Griffith B. Francois Jacob & Jacque Monod C. Har Gobind Khorana D. Meselson & Stahl List II: I. Genetic code II. Semi-conservative mode of DNA replication III. Transformation IV. Lac operon Choose the correct answer from the options given below.

Q69
NEET 2024

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end.

Q70
NEET 2024

Which of the following statements is correct regarding the process of replication in E.coli ?

Q71
NEET 2024

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

Q72
NEET 2024

Match List I with List II. List I: A. RNA polymerase III B. Termination of transcription C. Splicing of Exons D. TATA box List II: I. snRNP's II. Promotor III. Rho factor IV. SnRNAs, tRNA Choose the correct answer from the options given below.

Q73
NEET 2024

The lactose present in the growth medium of bacteria is transported to the cell by the action of:

Q74
NEET 2025

Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing B. Removing of introns and joining of exons C. Addition of methyl group at 5′ end of hnRNA. D. Addition of adenine residues at 3′ end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below:

Q75
NEET 2025

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

Q76
NEET 2025

Which factor is important for termination of transcription?

Q77
NEET 2025

Given below are two statements: Statement I: Transfer RNAs and ribosomal RNA do not interact with mRNA. Statement II: RNA interference (RNAi) takes places in all eukaryotic organisms as a method of cellular defence. In the light of the above statements, choose the most appropriate answer from the options given below:

Q78
NEET 2025

Histones are enriched with -

Q79
NEET 2025

Given below are two statements: Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes, RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In the light of the above statements, choose the most appropriate answer from the options given below:

Q80
NEET 2025

Which chromosome in the human genome has the highest number of genes?

Q81
NEET 2025

Silencing of specific mRNA is possible via RNAi because of -

Q82
NEET 2025

Match List-I with List-II. List-I: A. Alfred Hershey and Martha B. Euchromatin C. Frederick Griffith D. Heterochromatin List-II: I. Streptococcus pneumoniae II. Densely packed and dark-stained III. Loosely packed and light-stained IV. DNA as genetic material confirmation Choose the correct answer from the options given below:

Q83
NEET 2025

From the statements given below choose the correct option: A. The eukaryotic ribosomes are 80S and prokaryotic ribosomes are 70S. B. Each ribosome has two sub-units. C. The two sub-units of 80S ribosome are 60S and 40S while that of 70S are 50S and 30S. D. The two sub-units of 80S ribosome are 60S and 20S and that of 70S are 50S and 20S. E. The two sub-units of 80S are 60S and 30S and that of 70S are 50S and 30S.

Q84
NEET 2026 (1)

The sixth mutant codon of beta globin gene causing polymerization of Haemoglobin and change in RBC shape is ______.

Q85
NEET 2026 (1)

Which of the following statements are correct with reference to packaging of DNA helix ? A. Histones are organized to form a unit of eight molecules called histone octamer. B. Histones are negatively charged basic proteins. C. Histones are rich in the basic amino acid residues - lysine and arginine. D. The positively charged DNA is wrapped around the histone octamer to form nucleosome. E. The packaging of chromatin at higher levels requires an additional set of proteins called non-histone chromosomal proteins. Choose the correct answer from the options given below :

Q86
ReNEET 2026

Which of the following enzymes synthesizes precursor mRNA?

Q87
NEET 2026 (1)

Arrange the following steps of DNA fingerprinting in a correct sequence. A. Isolation of DNA and its digestion by restriction endonucleases. B. Hybridisation using a labelled VNTR probe. C. Transferring of separated DNA fragments to synthetic membranes. D. Detection of hybridised DNA fragments by autoradiography. E. Separation of DNA fragments by electrophoresis. Choose the correct answer from the options given below :

Q88
NEET 2026 (1)

In the lac operon, the z gene codes for

Q89
NEET 2026 (1)

Which of the following statements are correct with reference to a transcription unit? A. A transcription unit in DNA is defined primarily by three regions : promoter, structural gene and terminator. B. The promoter is said to be located towards the 5-end of the structural gene. C. The promoter is a DNA sequence that provides binding site for RNA polymerase. D. The promoter defines the template and coding strands. E. The terminator is located towards the 3-end of the coding strand and it defines the end of the process of transcription. Choose the correct answer from the options given below:

Want more Molecular Basis of Inheritance questions?

MedicNEET has 43,000+ NEET-style questions across Physics, Chemistry & Biology with detailed NCERT-based explanations — including the long, tricky questions that actually come in the exam.

Download MedicNEET App — Free

Molecular Basis of Inheritance — NEET PYQ Analysis

Molecular Basis of Inheritance is a Class 12 Zoology chapter that has been consistently tested in NEET from 2016 to 2026. This page contains 89 authentic previous year questions from actual NEET exam papers — not model questions or predictions.

Understanding how NEET frames questions from this chapter is crucial for scoring well. Topics frequently tested include . Check the NEET Biology chapter-wise weightage analysis to see how this chapter ranks based on 940 PYQ analysis. For comprehensive practice with detailed NCERT-based explanations, download the MedicNEET app which covers 17,000+ questions across the full Biology syllabus (43,000+ across all three subjects).

Study Molecular Basis of Inheritance Concept-by-Concept

Every NCERT paragraph from Molecular Basis of Inheritance that NEET has tested. Each is its own concept page with the question, answer and exam-pattern analysis. Ranked by how many times NEET has tested the paragraph.

View all 47 concepts from Molecular Basis of Inheritance