Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria?
Which of the following statements about the lac-operon is correct?
The correct statement regarding RNA and DNA, respectively is:
Which one of the following is the starter codon?
A molecule that can act as a genetic material must fulfill the traits given below, except
Which one of the following statements about Histones is wrong?
Two ways to go deeper on this chapter
Choose your next step
Which of the following is not required for any of the techniques of DNA fingerprinting available at present?
The equivalent of a structural gene is
DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the
A complex of ribosomes attached to single strand of RNA is known as:
Taylor conducted the experiments to prove semiconservative mode of chromosome replication on
Which of the following is required as inducer(s) for the expression of Lac operon?
Which of the following RNAs should be most abundant in animal cell?
During DNA replication, Okazaki fragments are used to elongate
A particular mRNA, in a hypothetical case, codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered?
DNA replication in bacteria occurs
The association of histone H1 with a nucleosome indicates:
Spliceosomes are not found in cells of
The final proof for DNA as the genetic material came from the experiments of
Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as
AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?
The experimental proof for semiconservative replication of DNA was first shown in a
Select the correct match. a. Matthew Meselson and F. Stahl - Pisum sativum b. Alfred Hershey and Martha Chase - TMV c. Alec Jeffreys - Streptococcus pneumoniae d. Francois Jacob and Jacques Monod - Lac operon
All of the following are part of an operon except
Match the following RNA polymerase with their transcribed products : Column I (a) RNA polymerase I (b) RNA polymerase II (c) RNA polymerase III Column II (i) tRNA (ii) rRNA (iii) hnRNA Select the correct option from the following
From the following, identify the correct combination of salient features of Genetic Code
Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?
Under which of the following conditions will there be no change in the reading frame of following mRNA? 5'AACAGCGGUGCUAUU3'
Which scientist experimentally proved that DNA is the sole genetic material in bacteriophage ?
What will be the sequence of mRNA produced by the following stretch of DNA ? 3'ATGCATGCATGCATG5' TEMPLATE STRAND 5'TACGTACGTACGTAC3' CODING STRAND
Purines found both in DNA and RNA are
Which of the following nucleic acids is present in an organism having 70S ribosomes only ?
Expressed Sequence Tags (ESTs) refers to :
Expressed Sequence Tags (ESTs) refers to
What initiation and termination factors are involved in transcription in Eukaryotes ?
In the process of transcription in Eukaryotes, the RNA polymerase I transcribes :-
Match the following genes of the Lac operon with their respective products : Column-I (a) i gene (b) z gene (c) a gene (d) y gene Column-II (i) β-galactosidase (ii) Permease (iii) Repressor (iv) Transacetylase Select the correct option.
If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 X 10^9 bp, then the length of the DNA is approximately
Which of the following statements is correct? a. Adenine pairs with thymine through three H-bonds b. Adenine does not pair with thymine c. Adenine pairs with thymine through two H-bonds d. Adenine pairs with thymine through one H-bond
The first phase of translation is:
Name the enzyme that facilitates opening of DNA helix during transcription.
What is the role of RNA polymerase III in the process of transcription in eukaryotes?
Which is the “Only enzyme” that has “Capability” to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?
Complete the flow chart on central dogma. (a) ____ (b) ____ (c) ____ (d) ____ (The flow chart shows DNA, with a self-directed arrow (a) back to DNA, an arrow (b) from DNA to RNA, an arrow (c) from RNA to (d).) a. (a)-Replication; (b)-Transcription; (c)-Translation; (d)-Protein b. (a)-Transduction; (b)-Translation; (c)-Replication; (d)-Protein c. (a)-Replication; (b)-Transcription; (c)-Transduction; (d)-Protein d. (a)-Translation; (b)-Replication; (c)-Transcription; (d)-Transduction
If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?
Identify the correct statement. a. The coding strand in a transcription unit is copied to an mRNA b. Split gene arrangement is characteristic of prokaryotes c. In capping, methyl guanosine triphosphate is added to the 3’ end of hnRNA. d. RNA polymerase binds with Rho factor to terminate the process of transcription in bacteria.
DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as:
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Which of the following RNAs is not required for the synthesis of protein?
The process of translation of mRNA to proteins begins as soon as:
Ten E. coli cells with 15N- dsDNA are incubated in a medium containing 14N nucleotides. After 60 minutes, how many E. coli cells will have DNA totally free from 15N?
If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?
DNA polymorphism forms the basis of:
If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of functions to different segment, the methodology adopted by him is called as:
In an E. coli strain the i gene gets mutated and its product can not bind the inducer molecule. If the growth medium is provided with lactose, what will be the outcome?
The last chromosome sequenced in Human Genome Project was :
Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.
Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:
Given below are two statements: Statement I: The codon 'AUG' codes for methionine and phenylalanine. Statement II: 'AAA' and 'AAG' both codons code for the amino acid lysine. In the light of the above statements, choose the correct answer from the options given below:
Among eukaryotes, replication of DNA takes place in
Unequivocal proof that DNA is the genetic material was first proposed by
Which scientist conducted an experiment with 32P and 35S labelled phages for demonstrating that DNA is the genetic material?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?
Given below are two statements : Statement I : The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Statement II : A transcription unit in DNA is defined primarily by the three regions in the DNA, i.e., a promotor, the structural gene and a terminator. In the light of the above statements, choose the correct answer from the options given below :
Given below are two statements: Statement I: RNA being unstable, mutate at a faster rate. Statement II: RNA can directly code for synthesis of proteins, hence can easily express the characters. In the light of the above statements, choose the correct answer from the options given below:
How many different proteins does the ribosome consist of?
The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific (D) The code is nearly universal Choose the most appropriate answer from the options given below :
Match List I with List II. List I: A. Frederick Griffith B. Francois Jacob & Jacque Monod C. Har Gobind Khorana D. Meselson & Stahl List II: I. Genetic code II. Semi-conservative mode of DNA replication III. Transformation IV. Lac operon Choose the correct answer from the options given below.
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end.
Which of the following statements is correct regarding the process of replication in E.coli ?
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
Match List I with List II. List I: A. RNA polymerase III B. Termination of transcription C. Splicing of Exons D. TATA box List II: I. snRNP's II. Promotor III. Rho factor IV. SnRNAs, tRNA Choose the correct answer from the options given below.
The lactose present in the growth medium of bacteria is transported to the cell by the action of:
Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing B. Removing of introns and joining of exons C. Addition of methyl group at 5′ end of hnRNA. D. Addition of adenine residues at 3′ end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below:
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
Which factor is important for termination of transcription?
Given below are two statements: Statement I: Transfer RNAs and ribosomal RNA do not interact with mRNA. Statement II: RNA interference (RNAi) takes places in all eukaryotic organisms as a method of cellular defence. In the light of the above statements, choose the most appropriate answer from the options given below:
Histones are enriched with -
Given below are two statements: Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes, RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In the light of the above statements, choose the most appropriate answer from the options given below:
Which chromosome in the human genome has the highest number of genes?
Silencing of specific mRNA is possible via RNAi because of -
Match List-I with List-II. List-I: A. Alfred Hershey and Martha B. Euchromatin C. Frederick Griffith D. Heterochromatin List-II: I. Streptococcus pneumoniae II. Densely packed and dark-stained III. Loosely packed and light-stained IV. DNA as genetic material confirmation Choose the correct answer from the options given below:
From the statements given below choose the correct option: A. The eukaryotic ribosomes are 80S and prokaryotic ribosomes are 70S. B. Each ribosome has two sub-units. C. The two sub-units of 80S ribosome are 60S and 40S while that of 70S are 50S and 30S. D. The two sub-units of 80S ribosome are 60S and 20S and that of 70S are 50S and 20S. E. The two sub-units of 80S are 60S and 30S and that of 70S are 50S and 30S.
The sixth mutant codon of beta globin gene causing polymerization of Haemoglobin and change in RBC shape is ______.
Which of the following statements are correct with reference to packaging of DNA helix ? A. Histones are organized to form a unit of eight molecules called histone octamer. B. Histones are negatively charged basic proteins. C. Histones are rich in the basic amino acid residues - lysine and arginine. D. The positively charged DNA is wrapped around the histone octamer to form nucleosome. E. The packaging of chromatin at higher levels requires an additional set of proteins called non-histone chromosomal proteins. Choose the correct answer from the options given below :
Which of the following enzymes synthesizes precursor mRNA?
Arrange the following steps of DNA fingerprinting in a correct sequence. A. Isolation of DNA and its digestion by restriction endonucleases. B. Hybridisation using a labelled VNTR probe. C. Transferring of separated DNA fragments to synthetic membranes. D. Detection of hybridised DNA fragments by autoradiography. E. Separation of DNA fragments by electrophoresis. Choose the correct answer from the options given below :
In the lac operon, the z gene codes for
Which of the following statements are correct with reference to a transcription unit? A. A transcription unit in DNA is defined primarily by three regions : promoter, structural gene and terminator. B. The promoter is said to be located towards the 5-end of the structural gene. C. The promoter is a DNA sequence that provides binding site for RNA polymerase. D. The promoter defines the template and coding strands. E. The terminator is located towards the 3-end of the coding strand and it defines the end of the process of transcription. Choose the correct answer from the options given below:
Want more Molecular Basis of Inheritance questions?
MedicNEET has 27,000+ NEET-style questions across Physics, Chemistry & Biology with detailed NCERT-based explanations — including the long, tricky questions that actually come in the exam.
Download MedicNEET App — Free