Biology · Molecular Basis of Inheritance · NEET
The TEMPLATE strand is copied. RNA polymerase reads the template strand (3'→5' polarity) and builds the RNA in the 5'→3' direction. The coding strand is NOT copied; it is only displaced during transcription. This is exactly what NEET 2016 asked: 'RNA polymerase catalyzes transcription on one strand which is called the...' Answer: Template strand.
This confuses many students, and NCERT even calls it 'strange'. The coding strand does NOT code for anything and is not read. It gets its name only because its sequence is the SAME as the mRNA (with T instead of U). By convention, all reference points of a transcription unit are written using the coding strand, so it is named the coding strand even though it is not the one copied.
The TEMPLATE strand has 3'→5' polarity. RNA polymerase only makes RNA in the 5'→3' direction, so it needs a template that runs 3'→5'. The coding strand has the opposite polarity, 5'→3', the same direction as the mRNA that is produced.
The mRNA has the SAME sequence and SAME polarity (5'→3') as the CODING strand, except that every thymine (T) is replaced by uracil (U). The mRNA is COMPLEMENTARY to the template strand. So to write an mRNA from the coding strand, just copy it and change T to U. This is NEET 2018 and NEET 2023.
Simple 2-step rule for NEET: (1) keep the exact same sequence and same 5'→3' direction as the coding strand, (2) replace every T with U. Example: coding strand 5'-AGGTATCGCAT-3' gives mRNA 5'-AGGUAUCGCAU-3'. Do NOT complement the coding strand — that is the common trap.
Yes. The coding strand is also called the SENSE strand (it makes 'sense' like the mRNA). The template strand is also called the ANTISENSE strand. NCERT mainly uses the terms coding strand and template strand, so use those for NEET, but know the synonyms.
DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the
AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG3'?
Try the real previous-year questions from this chapter — each with the answer and a full solution.
The template strand (3'→5' polarity) is read by RNA polymerase. RNA is built in the 5'→3' direction and is complementary to this template.
Almost. The coding strand has the same sequence and same 5'→3' direction as the mRNA, but DNA has thymine (T) where RNA has uracil (U).
Because RNA polymerase can add nucleotides only to the 3' end of the growing RNA, so it synthesises 5'→3'. To do that it must move along a template running 3'→5'.
By convention, all reference points of a transcription unit are written using the coding strand, even though the coding strand is not the one copied.
Yes. Template strand = antisense strand. Coding strand = sense strand. NCERT prefers the terms template and coding for NEET.
