NEET 2024 · BiologyPrevious Year Question

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

Answer: (D) 5’AUGUACCGUUUAUAGGUAAGU3’. Answer: (D) 5'AUGUACCGUUUAUAGGUAAGU3'.

  1. A.5’AUGUAAAGUUUAUAGGUAAGU3’
  2. B.5’AUGUACCGUUUAUAGGGAAGU3’
  3. C.5’ATGTACCCTTTATAGGTAAGT3’
  4. D.5’AUGUACCGUUUAUAGGUAAGU3’

Correct Answer

(D) 5’AUGUACCGUUUAUAGGUAAGU3’

Solution & Explanation

Answer: (D) 5'AUGUACCGUUUAUAGGUAAGU3'. RNA is synthesised complementary to the 3'->5' template, in the 5'->3' direction, with U opposite A. Reading template 3'TACATGGCAAATATCCATTCA5' gives RNA 5'AUGUACCGUUUAUAGGUAAGU3', which matches option D (its 'VV' is an OCR garble for 'CC'). NCERT Ch 5, p.92, lines 004-009: "the strand that has the polarity 3'->5' acts as a template... The other strand which has the polarity (5'->3') and the sequence same as RNA (except thymine at the place of uracil)."

🎯
43,000+ questions in हिंदी & English · one-tap toggle
Practice NEET 2024 Biology — free, with instant solutions
43,000+ NEET questions solved step-by-step, chapter-wise, in the MedicNEET app.
📚Practice all NEET Biology PYQs chapter-wise 💡Don't get it? Learn the Molecular Basis of Inheritance concepts

More NEET PYQ solutions

BiolWhich one of the following is an example of ex-situ conservation?BiolWhich of the following is an example of a zygomorphic flower? (NEET 2025)BiolWhich of the following is an example of actinomorphic flower? (NEET 2024)BiolIn the seeds of cereals, the outer covering of endosperm separates the embryo by a protein-rich layer called : (NEET 2025)BiolGiven below are two statements: Statement I : In a floral formula the symbol [percentage/division-type symbol] stands for zygomorphic nature of the flower, and G with a bar above it stands for inferior ovary. Statement II : In a floral formula the symbol [same symbol] stands for actinomorphic nature of the flower and G with a bar below it stands for superior ovary. In the light of the above statements, choose the correct answer from the options given below: (NEET 2025)BiolMatch List I with List II: List I — A. Scutellum; B. Non-albuminous seed; C. Epiblast; D. Perisperm. List II — I. Persistent nucellus; II. Cotyledon of Monocot seed; III. Groundnut; IV. Rudimentary cotyledon. Choose the option with all correct matches. (NEET 2025)BiolGiven below are the stages in the life cycle of pteridophytes. Arrange the following stages in the correct sequence. A. Prothallus stage B. Meiosis in spore mother cells C. Fertilisation D. Formation of archegonia and antheridia in gametophyte. E. Transfer of antherozoids to the archegonia in presence of water. Choose the correct answer from the options given below:BiolThe correct sequence of events in the life cycle of bryophytes is A. Fusion of antherozoid with egg. B. Attachment of gametophyte to substratum. C. Reduction division, to produce haploid spores. D. Formation of sporophyte. E. Release of antherozoids into water. Choose the correct answer from the options given below: