Medicneet Logo

NEET 2024 Physics & Chemistry PYQ — Questions with Answers & Solutions

All 110 NEET 2024 Physics & Chemistry previous year questions, each with the correct answer and a step-by-step solution. Free — tap any question to solve it.

NEET 2024 Physics — 56 Questions

  1. 1A bob is suspended by a light string from the roof of a truck. The truck, initially stationary, suddenly moves to the…
  2. 2Two bodies A and B of the same mass undergo a completely inelastic one-dimensional collision. A moves with velocity v₁…
  3. 3An object flying in air with velocity (20î + 25ĵ + 12k̂) suddenly breaks into two pieces whose masses are in the ratio…
  4. 4A horizontal force of 10 N is applied to block A, which is in contact with and pushes block B on a frictionless…
  5. 5A bob is whirled in a horizontal circle by a string at an initial angular speed ω, and the tension in the string is T.…
  6. 6A body of mass m is kept on a rough horizontal surface (coefficient of friction μ). A horizontal force is applied but…
  7. 7A person standing on the floor of an elevator drops a coin. The coin reaches the floor in time t₁ if the elevator is at…
  8. 8In the following circuit, the equivalent capacitance between terminal A and terminal B is:
  9. 9Assertion A: The potential (V) at any axial point, at 2m distance (r) from the centre of the dipole of dipole moment…
  10. 10A thin spherical shell is charged by some source. The potential difference between the two points C and P (in V) shown…
  11. 11If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then: A. The charge…
  12. 12Choose the correct circuit which can achieve the bridge balance. (Arms 100 , 10 , 15 , 5 with galvanometer G and cell E…
  13. 13A wire of resistance 100 is divided into 10 equal parts. The first 5 are connected in series, the next 5 in parallel…
  14. 14The terminal voltage of a battery of emf 10 V and internal resistance 1 , connected to an external resistance of 4 , is:
  15. 15Two heaters A and B rated 1 kW and 2 kW are connected first in series and then in parallel to a fixed source. The ratio…
  16. 16In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds. The moment of…
  17. 17An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms make an…
  18. 18Match List-I with List-II: List-I (Material) A. Diamagnetic B. Ferromagnetic C. Paramagnetic D. Non-magnetic List-II…
  19. 19A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to: A. hold the sheet…
  20. 20A logic circuit provides the output Y as per the following truth table: A B Y 0 0 1 0 1 0 1 0 1 1 1 0 The expression…
  21. 21Consider the following statements A and B and identify the correct answer: A. For a solar cell, the I-V characteristic…
  22. 22The output (Y) of the given logic gate is similar to the output of an/a:
  23. 23A force defined by F = αt + βt² acts on a particle at a given time t. The factor which is dimensionless, if α and β are…
  24. 24In a vernier callipers, (N+1) divisions of the vernier scale coincide with N divisions of the main scale. If 1 MSD…
  25. 25The quantities which have the same dimensions as those of solid angle are:
  26. 26The values of Cp/Cv for hydrogen, helium and another ideal diatomic gas X (whose molecules are not rigid but have an…
  27. 27The volume occupied by 1.8 g of water vapour at 374 °C and 1 bar pressure will be: [Use R = 0.083 bar L K⁻¹ mol⁻¹]
  28. 28The following graph represents the T–V curves of an ideal gas (where T is the temperature and V the volume) at three…
  29. 29Given below are two statements: Statement I: Atoms are electrically neutral as they contain equal number of positive…
  30. 30Match List I with List II: List I (Spectral Lines of Hydrogen for transitions from) (A) n₂ = 3 to n₁ = 2 (B) n₂ = 4 to…
  31. 31If the monochromatic source in Young's double slit experiment is replaced by white light, then
  32. 32An unpolarized light beam strikes a glass surface at Brewster's angle. Then
  33. 33Two bodies A and B of the same mass undergo a completely inelastic one-dimensional collision. Body A moves with…
  34. 34At any instant of time t, the displacement of a particle is given by x=2t-1 (SI units), under the influence of a force…
  35. 35A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the…
  36. 36The property which is NOT of an electromagnetic wave travelling in free space is that
  37. 37A metallic bar of Young's modulus 0.5 × 10¹¹ N m⁻² and coefficient of linear thermal expansion 10⁻⁵ °C⁻¹, length 1 m…
  38. 38The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young's modulus respectively…
  39. 39A small telescope has an objective of focal length 140 cm and an eyepiece of focal length 5.0 cm. The magnifying power…
  40. 40A light ray enters through a right-angled prism at point P with the angle of incidence 30° as shown in the figure. It…
  41. 41If x = 5 sin(πt + π/3) m represents the motion of a particle executing simple harmonic motion, then the amplitude and…
  42. 42If the mass of the bob of a simple pendulum is increased to thrice its original mass and its length is made half its…
  43. 43In an ideal transformer, the turns ratio is N_p/N_s = 1/2. The ratio V_s : V_p is equal to (the symbols carry their…
  44. 44A 10 μF capacitor is connected to a 210 V, 50 Hz source as shown in figure. The peak current in the circuit is nearly…
  45. 45If c is the velocity of light in free space, the correct statements about a photon among the following are: A. The…
  46. 46The graph which shows the variation of (1/λ)² and the kinetic energy E of a free particle (where λ is the de Broglie…
  47. 47The minimum energy required to launch a satellite of mass m from the surface of the earth (mass M, radius R) into a…
  48. 48The mass of a planet is 1/10th that of the earth and its diameter is half that of the earth. The acceleration due to…
  49. 49The velocity (v)-time (t) graph of a body moving in a straight line is shown. Which of the following acceleration…
  50. 50The moment of inertia of a thin rod about an axis through its mid-point and perpendicular to its length is 2400 g·cm².…
  51. 51A particle moving with uniform speed in a circular path maintains:
  52. 52A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the…
  53. 53A metallic bar (Young's modulus Y = 0.5 × 10¹¹ N m⁻², coefficient of linear expansion α = 10⁻⁵ °C⁻¹, length 1 m, area…
  54. 54A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is
  55. 55A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If the surface tension of water…
  56. 56In the above diagram, 1 strong bar magnet is moving towards solenoid - 2 from solenoid - 1. The direction of induced…

NEET 2024 Chemistry — 54 Questions

  1. 1The most stable carbocation among the following is:
  2. 2The most stable carbocation among the following is:
  3. 3The most stable carbocation among the following is:
  4. 4The compound that will undergo SN1 reaction with the fastest rate is:
  5. 5A compound with a molecular formula C6H14 has two tertiary carbons. Its IUPAC name is:
  6. 6On heating, some solid substances change from the solid to the vapour state without passing through the liquid state.…
  7. 7A compound X contains 32% of A, 20% of B and the remaining percentage of C. The empirical formula of X is (given atomic…
  8. 8A compound with a molecular formula of C6H14 has two tertiary carbons. Its IUPAC name is:
  9. 9Given below are two statements: Statement I: The boiling point of three isomeric pentanes follows the order n-pentane >…
  10. 10Match List-I with List-II. List-I (Reaction): A. Cyclohexene (cyclic alkene) open-chain dicarbonyl compound B. Benzene…
  11. 11For the given reaction, 'P' is: C6H5-CH=CH-C6H5 ->[KMnO4/H+] P (major product) (stilbene undergoes oxidation with hot…
  12. 12The compound that will undergo S_N1 reaction with the fastest rate is
  13. 13The products A and B obtained in the following reactions, respectively are 3 ROH + PCl3 -> 3 RCl + A ROH + PCl5 -> RCl…
  14. 14Identify the major product C formed in the following reaction sequence: CH3CH2CH2I ->[NaCN] A ->[partial…
  15. 15Major products A and B formed in the following reaction sequence are: 2-methylcyclohexan-1-ol ->[PBr3] A (major)…
  16. 16Identify the correct reagents that would bring about the following transformation (an alkene converted, via the…
  17. 17Which one of the following alcohols reacts instantaneously with Lucas reagent?
  18. 18The products A and B obtained in the following reactions, respectively, are: 3 ROH + PCl3 -> 3 RCl + A ROH + PCl5 ->…
  19. 19Identify the correct reagents that would bring about the following transformation: C6H5-CH2-CH=CH2 -> C6H5-CH2-CH2-CHO…
  20. 20Identify the correct answer.
  21. 21Match List-I with List-II. List-I (Molecule): A. ethane; B. ethene; C. carbon molecule, C2; D. ethyne List-II (Number…
  22. 22Match List-I with List-II. List-I (Compound): A. NH3; B. BrF5; C. XeF4; D. SF6 List-II (Shape/geometry): I. Trigonal…
  23. 23Intramolecular hydrogen bonding is present in which of the following compounds? (Structures (A), (B) and (D) are shown…
  24. 24'Spin only' magnetic moment is same for which of the following ions? A. Ti^3+ B. Cr^2+ C. Mn^2+ D. Fe^2+ E. Sc^3+…
  25. 25Match List-I with List-II: List-I (Complex) (a) [Co(NH3)5(NO2)]Cl2 (b) [Co(NH3)5(SO4)]Br (c) [Co(NH3)6][Cr(CN)6] (d)…
  26. 26Given below are two statements: Statement I: Both [Co(NH3)6]^3+ and [CoF6]^3- complexes are octahedral but differ in…
  27. 27Given below are two statements: Statement I: [Co(NH3)6]^3+ is a homoleptic complex whereas [Co(NH3)4Cl2]+ is a…
  28. 28Fehling's solution 'A' is:
  29. 29Match List-I with List-II: List-I (Reaction) (a) C6H6 -> C6H5-CO-C6H5 (benzophenone) (b) Alkene -> carbonyl (oxidative…
  30. 30Identify the correct reagents that would bring about the transformation C6H5-CH2-CH=CH2 -> C6H5-CH2-CH2-CHO…
  31. 31Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N.
  32. 32Among Group 16 elements, which one does NOT show the -2 oxidation state?
  33. 33Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si.
  34. 34The highest number of helium atoms is present in
  35. 351 gram of NaOH is treated with 25 mL of 0.75 M HCl solution. The mass of NaOH left unreacted is
  36. 36A compound X contains 32% of A, 20% of B and the remaining percentage of C. The empirical formula of X is (atomic…
  37. 37'Spin only' magnetic moment is same for which of the following ions? A. Ti^3+ B. Cr^2+ C. Mn^2+ D. Fe^2+ E. Sc^3+…
  38. 38The E^° value for the Mn^3+/Mn^2+ couple is more positive than that of Cr^3+/Cr^2+ or Fe^3+/Fe^2+ due to the change of
  39. 39The pair of lanthanoid ions which are diamagnetic is
  40. 40Fehling's solution 'A' is
  41. 41The reagents with which glucose does NOT react to give the corresponding test/product are: A. Tollen's reagent B.…
  42. 42In which of the following processes does entropy increase? A. A liquid evaporates to vapour. B. Temperature of a…
  43. 43The work done during the reversible isothermal expansion of one mole of hydrogen gas at 25^ from a pressure of 20…
  44. 44The Henry's law constant (K_H) values of three gases (A, B, C) in water are 145, 2 × 10-5 and 35 kbar, respectively.…
  45. 45The plot of osmotic pressure ( ) vs concentration (mol L⁻¹) for a solution gives a straight line with slope 25.73 L bar…
  46. 46Match List-I with List-II: List-I (Conversion) (A) 1 mol of H2O to O2 (B) 1 mol of MnO4- to Mn^2+ (C) 1.5 mol of Ca…
  47. 47Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution…
  48. 48Which of the following plots of k versus 1/T is consistent with the Arrhenius equation?
  49. 49Activation energy of any chemical reaction can be calculated if one knows the value of
  50. 50Given below are two statements: Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II…
  51. 51Identify the major product C formed in the following reaction sequence: CH3CH2CH2I ->[NaCN] A ->[OH^-/NaOH][partial…
  52. 52The energy of an electron in the ground state (n=1) for the He+ ion is -x J. Then the energy of an electron in the n=2…
  53. 53Match List-I with List-II: List-I (Quantum Number) (A) m_l (B) m_s (C) l (D) n List-II (Information provided) (I) shape…
  54. 54Which reaction is NOT a redox reaction?

NEET 2024 Biology — 94 Questions

Prefer chapter-wise? Solve NEET Biology PYQs by chapter.

  1. 1Flippers of Penguins and Dolphins are examples of:
  2. 2The flippers of the Penguins and Dolphins are the example of the
  3. 3Given below are two statements: Statement I: Gause's competitive exclusion principle states that two closely related…
  4. 4Match List I with List II: List I List II A. Common cold B. Haemozoin C. Widal test D. Allergy I. Plasmodium II.…
  5. 5Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular…
  6. 6Match List I with List II: List I List II A. Cocaine B. Heroin C. Morphine D. Marijuana I. Effective sedative in…
  7. 7Match List I with List II: List I List II A. Typhoid B. Leishmaniasis C. Ringworm D. Filariasis I. Fungus II. Nematode…
  8. 8Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A…
  9. 9Given below are two statements: Statement I: Bone marrow is the main lymphoid organ where all blood cells including…
  10. 10Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the…
  11. 11Identify the part of seed from the given figure which is destined to form root when the seed germinates.
  12. 12Match List I with List II. List I (A. Rose, B. Pea, C. Cotton, D. Mango) List II (I. Twisted aestivation, II.…
  13. 13Match List I with List II. List I (Types of Stamens) (A. Monadelphous, B. Diadelphous, C. Polyadelphous, D.…
  14. 14Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of
  15. 15Match list I with list II. List I: A. GLUT-4; B. Insulin; C. Trypsin; D. Collagen List II: I. Hormone; II. Enzyme; III.…
  16. 16Regarding catalytic cycle of an enzyme action, select the correct sequential steps: A. Substrate enzyme complex…
  17. 17Lecithin, a small molecular weight organic compound found in living tissues, is an example of
  18. 18The cofactor of the enzyme carboxypeptidase is
  19. 19Match List I with List II: List I: A. Lipase; B. Nuclease; C. Protease; D. Amylase List II: I. Peptide bond; II. Ester…
  20. 20A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are…
  21. 21In a plant, black seed color (BB/bb) is dominant, over white seed color (bb). In order to find out the genotype of the…
  22. 22As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective…
  23. 23Match List I with List II: List I A. Down's syndrome B. α-Thalassemia C. β-Thalassemia D. Klinefelter's syndrome List…
  24. 24Match List I with List II. List I A. Two or more alternative forms of a gene B. Cross of F1 progeny with homozygous…
  25. 25Which one of the following can be explained on the basis of Mendel's law of Dominance? A. Out of one pair of factors…
  26. 26Match List I with List II. List I: A. Frederick Griffith B. Francois Jacob & Jacque Monod C. Har Gobind Khorana D.…
  27. 27A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and…
  28. 28Which of the following statements is correct regarding the process of replication in E.coli ?
  29. 29Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
  30. 30Match List I with List II. List I: A. RNA polymerase III B. Termination of transcription C. Splicing of Exons D. TATA…
  31. 31The lactose present in the growth medium of bacteria is transported to the cell by the action of:
  32. 32The following are the statements about non-chordates: A. Pharynx is perforated by gill slits. B. Notochord is absent.…
  33. 33Match List I with List II: List I A. Pterophyllum B. Myxine C. Pristis D. Exocoetus List II I. Hag fish II. Saw fish…
  34. 34Match List I with List II: List I A. Pleurobrachia B. Radula C. Stomochord D. Air bladder List II I. Mollusca II.…
  35. 35Consider the following statements: A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes…
  36. 36Match List I with List II: List I A. Axoneme B. Cartwheel pattern C. Crista D. Satellite List II I. Centriole II. Cilia…
  37. 37The DNA present in chloroplast is
  38. 38Given below are two statements : Statement I : Mitochondria and chloroplasts are both double membrane bound organelles.…
  39. 39Match list I with list II. List I A. Nucleolus B. Centriole C. Leucoplasts D. Golgi apparatus List II I. Site of…
  40. 40Formation of interfascicular cambium from fully developed parenchyma cells is an example for
  41. 41Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
  42. 42The capacity to generate a whole plant from any cell of the plant is called
  43. 43Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus…
  44. 44The type of conservation in which the threatened species are taken out from their natural habitat and placed in special…
  45. 45These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat…
  46. 46List of endangered species was released by
  47. 47Match List I with List II. List I A. Robert May B. Alexander von Humboldt C. Paul Ehrlich D. David Tilman List II I.…
  48. 48Following are the stages of cell division: A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1…
  49. 49Given below are two statements. Statement 1: Chromosomes become gradually visible under light microscope during…
  50. 50Match List-I with List-II: List-I (Sub Phases of Prophase I) A. Diakinesis B. Pachytene C. Zygotene D. Leptotene…
  51. 51Spindle fibres attach to kinetochores of chromosomes during
  52. 52Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B.…
  53. 53Which of the following factors will not affect the Hardy-Weinberg equilibrium?
  54. 54Identify the part seed from the given figure which is destined to form root when the seed germinates.
  55. 55Identify the set of correct statements: A. The flowers of Vallisneria are colorful and produce nectar. B. The flowers…
  56. 56Identify the correct description about given figure.
  57. 57How many molecules of ATP and NADPH are required for every molecule of CO2 fixed in the Calvin cycle
  58. 58Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO2 D. ATP E.…
  59. 59Given below are two statements. Statement 1: in C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.…
  60. 60Bulliform cells are responsible for
  61. 61In the given figure of the stomatal apparatus, which component has thin outer walls and highly thickened inner walls?
  62. 62Given below are two statements. Statements: Statement I: Parenchyma is living but collenchyma is dead tissue. Statement…
  63. 63Following are the stages of pathway for conduction of an action potential through the heart A. AV bundle B. Purkinje…
  64. 64As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective…
  65. 65Match List I with List II: List I A. P Wave B. QRS complex C. T wave D. T-P gap List II I. Heart muscles are…
  66. 66Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A…
  67. 67Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: FSH…
  68. 68Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis. (NEET 2024)
  69. 69Match List I with List II. List I A. Exophthalmic goiter B. Acromegaly C. Cushing's syndrome D. Cretinism List II I.…
  70. 70Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: FSH…
  71. 71Which of the following is not a steroid hormone?
  72. 72The equation of Verhulst-Pearl logistic growth is dN/dt = rN[(K-N)/K]. From this equation, K indicates. (NEET 2024)
  73. 73Given below are two statements: Statement I: In the nephron, the descending limb of loop of Henle is impermeable to…
  74. 74Choose the correct statement given below regarding juxta medullary nephron.
  75. 75Which of the following is not a natural/traditional contraceptive method? (NEET 2024)
  76. 76Match List I with List II: List I (A) Non-medicated IUD (B) Copper releasing IUD (C) Hormone releasing IUD (D) Implants…
  77. 77Given below are two statements: Statement I: The cerebral hemispheres are connected by a nerve tract known as corpus…
  78. 78Match List I with List II: List I A. Pons B. Hypothalamus C. Medulla D. Cerebellum List II I. Provides additional space…
  79. 79Match List I with List II. List I A. Unicellular glandular epithelium B. Compound epithelium C. Multicellular glandular…
  80. 80Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in the…
  81. 81Match List I with List II: List I: A. Fibrous joints B. Cartilaginous joints C. Hinge D. Ball and socket joints List…
  82. 82Three types of muscle tissue are shown as (a), (b) and (c): (a) Long, parallel, cylindrical striated (cross-banded)…
  83. 83Which one of the following is not a criterion for classification of fungi?
  84. 84Match List I with List II: List I A. Rhizopus B. Ustilago C. Puccinia D. Agaricus List II I. Mushroom II. Smut fungus…
  85. 85Match List I with List II: List I A. Expiratory capacity B. Functional residual capacity C. Vital capacity D.…
  86. 86Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
  87. 87Given below are two statements: Statement I: Bt toxins are insect group specific and coded by a gene cry 1Ac. Statement…
  88. 88Match List I with List II. List I A. α-1 antitrypsin B. Cry 1Ab C. Cry 1Ac D. Enzyme replacement therapy List II I.…
  89. 89The "Ti plasmid" of Agrobacterium tumefaciens stands for
  90. 90The following diagram showing restriction sites in E coli cloning vector pBR322. Find the role of 'X' and 'Y' genes:
  91. 91In an ecosystem if the Net primary Productivity (NPP) of first trophic level is 100x kcal m⁻² yr⁻¹, what would be the…
  92. 92Match List I with List II. List I List II A. Clostridium butylicum I. Ethanol B. Saccharomyces cerevisiae II.…
  93. 93Match List I with List II: List I A. Citric acid cycle B. Glycolysis C. Electron transport system D. Proton gradient…
  94. 94Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual…
🎯
43,000+ questions in हिंदी & English · one-tap toggle
Solve NEET 2024 in the MedicNEET app — free
43,000+ NEET questions, chapter-wise, with instant step-by-step solutions and an All-India rank.

Solve other NEET years

NEET 2025NEET 2026 (Phase 1)NEET 2023 Phase 2NEET 2023 Phase 1NEET 2022NEET 2021NEET 2020NEET 2019 OdishaNEET 2019NEET 2018NEET 2017NEET 2016 Phase 2NEET 2016 Phase 1
More: All NEET PYQs · Physics PYQs · Chemistry PYQs · Previous year papers