NEET 2023 Biology Questions

The dissolution of synaptonemal complex occurs during

Dissolution of the synaptonemal complex occurs during:

Which of the following stages of meiosis involves division of centromere?

Which of the following stages of meiosis involves division of centromere?

Among eukaryotes, replication of DNA takes place in

Doubling of the number of chromosomes can be achieved by disrupting mitotic cell division soon after

Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:

Given are two statements. Statement 1: During G0 phase of cell cycle, the cell is metabolically inactive. Statement 2: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:

During which stages of mitosis and meiosis, respectively does the centromere of each chromosome split?

Which one of the following is the quiescent stage of cell cycle ?

Select correct sequence of substages of Prophase-I of meiotic division: (A) Zygotene (B) Pachytene (C) Diakinesis (D) Leptotene (E) Diplotene

Match List I with List II: List I A. M Phase B. G2 Phase C. G1 Phase D. G1 Phase List II I. Proteins are synthesized II. Inactive phase III. Interval between mitosis and initiation of DNA replication IV. Equational division Choose the correct answer from the options given below:

The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?

Match List-I with List-II. List-I: (A) Terpenoides (B) Lectins (C) Alkaloids (D) Toxins List-II: (I) Codeine (II) Diterpenes (III) Ricin (IV) Concanavalin A Choose the correct answer from the options given below:

Cellulose does not form blue colour with Iodine because

Which of the following is not a secondary metabolite?

Match List-I with List-II. List-I: (A) Protein (B) Unsaturated fatty acid (C) Nucleic acid (D) Polysaccharide List-II: (I) C = C double bonds (II) Phosphodiester bond (III) Glycosidic bonds (IV) Peptide bonds Choose the correct answer from the options given below:

Inulin is a polymer of:

Given below are two statements: Statement I: RuBisCO is the most abundant enzyme in the world. Statement II: Photorespiration does not occur in C4 plants. In the light of the above statements, choose the most appropriate answer from the options given below:

Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal) Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of alpha type and two subunits of beta type.) In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:

Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

Which of the following statements is correct?

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion (A): Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. Reason (R): Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below:

Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below:

The Cockroach is :

Arrange the events of Renin – Angiotensin mechanism in correct sequence. (A) Activation of JG cell and release of renin. (B) Angiotensin II activates release of aldosterone. (C) Fall in glomerular blood pressure. (D) Reabsorption of Na+ and water from distal convoluted tubule. (E) Angiotensinogen is converted to Angiotensin I and then to Angiotensin II. Choose the correct answer from the options given below :

In cockroach, excretion is brought about by A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below:

Match List I with List II: List I A. Taenia B. Paramoecium C. Periplaneta D. Pheretima List II I. Nephridia II. Contractile vacuole III. Flame cells IV. Urecose gland Choose the correct answer from the options given below:

Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A) : Ascending limb of loop of Henle is impermeable to water and allows transport of electrolytes actively or passively. Reason (R) : Dilution of filtrate takes place due to efflux of electrolytes in the medullary fluid. In the light of the above statements, choose the correct answer from the options given below :

Which of the following statements is not correct?

Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic Reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:

Which of the following functions is carried out by cytoskeleton in a cell?

Which of the following statements are correct with respect to Golgi apparatus? (A) It is the important site of formation of glycoprotein and glycolipids. (B) It produces cellular energy in the form of ATP. (C) It modifies the protein synthesized by ribosomes on ER. (D) It facilitates the transport of ions. (E) It provides mechanical support. Choose the most appropriate answer from the options given below :

How many different proteins does the ribosome consist of?

Movement and accumulation of ions across a membrane against their concentration gradient can be explained by

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: Statement I : In bacteria, the mesosomes are formed by the extensions of plasma membrane. Statement II : The mesosomes, in bacteria, help in DNA replication and cell wall formation. In the light of the above statements, choose the most appropriate answer from the options given below:

Which of the following statements is not correct?

In tissue experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as:

The phenomenon which is influenced by auxin and also played a major role in its discovery :

Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?

Which hormone promotes internode/petiole elongation in deep water rice?

Match List-I with List-II List-I: (A) Auxin (B) Gibberellin (C) Cytokinin (D) Ethylene List-II: (I) Promotes female flower formation in cucumber (II) Overcoming apical dominance (III) Increase in the length of grape stalks (IV) Promotes flowering in pineapple Choose the correct answer from the options given below:

Removal of shoot tips is a very useful technique to boost the production of tea-leaves. This is because

In order to increase the yield of sugarcane crop, which of the following plant growth regulators should be sprayed?

Which of the following is incorrectly matched?

Which of the following statements is true?

Which of the following statements is correct?

Which classes of algae possess pigment fucoxanthin and pigment phycoerythrin, respectively?

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A: In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R: Air currents carry the pollen grains to the mouth of the archegonia where the gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A: The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R: Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from the options given below:

Match List-I with List-II. List-I (A) Pteropsida (B) Lycopsida (C) Psilopsida (D) Sphenopsida List-II (I) Psilotum (II) Equisetum (III) Adiantum (IV) Selaginella Choose the correct answer from the options given below:

Identify the pair of heterosporous pteridophytes among the following:

Which of the following statements are correct with respect to the hormone and its function? (A) Thyrocalcitonin (TCT) regulates the blood calcium level. (B) In males, FSH and androgens regulate spermatogenesis. (C) Hyperthyroidism can lead to goitre. (D) Glucocorticoids are secreted in Adrenal Medulla. (E) Parathyroid hormone is regulated by circulating levels of sodium ions. Choose the most appropriate answer from the options given below :

Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune system E. Support the process of R.B.Cs formation Choose the correct answer from the options given below:

Given below are two statements: Statement I : Parathyroid hormone acts on bones and stimulates the process of bone resorption. Statements II : Parathyroid hormone along with Thyrocalcitonin plays a significant role in carbohydrate metabolism. In the light of the above statements, choose the correct answer from the options given below :

Match List I with List II. List I (Hormone): A. CCK B. GIP C. ANF D. ADH List II (Source): I. Kidney II. Heart III. Gastric gland IV. Pancreas Choose the correct answer from the options given below:

Select incorrect statement, regarding chemical structure of insulin.

Arrange the events of Renin – Angiotensin mechanism in correct sequence. (A) Activation of JG cell and release of renin. (B) Angiotensin II activates release of aldosterone. (C) Fall in glomerular blood pressure. (D) Reabsorption of Na+ and water from distal convoluted tubule. (E) Angiotensinogen is converted to Angiotensin I and then to Angiotensin II. Choose the correct answer from the options given below :

Arrange the sequence of different hormones for their role during gametogenesis. (A) Gonadotropin LH stimulates synthesis and secretion of Androgen (B) Gonadotropin releasing hormone from hypothalamus (C) Androgen stimulates spermatogenesis (D) Gonadotropin FSH helps in the process of spermiogenesis (E) Gonadotropins from anterior pituitary gland Choose the correct answer from the options given below:

How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle?

The reaction centre in PS II has an absorption maxima at

Which micronutrient is required for splitting of water molecule during photosynthesis?

Which of the following combinations is required for chemiosmosis?

Match List I with List II and choose the correct answer: List I A. Chlorophyll a B. Chlorophyll b C. Xanthophyll D. Carotenoid List II I. Yellow to yellow orange II. Yellow green III. Blue green IV. Yellow Choose the correct answer from the options given below:

Given below are two statements : Statement I: RuBisCO is the most abundant enzyme in the world. Statement II: Photorespiration does not occur in C4 plants. In the light of the above statements, choose the most appropriate answer from the options given below :

Select the correct statements: A. Platyhelminthes are triploblastic pseudocoelomate and bilaterally symmetrical organisms. B. Ctenophores reproduce only sexually and fertilization is external. C. In tapeworm, fertilization is internal but sexes are not separate. D. Ctenophores are exclusively marine, diploblastic and bioluminescent organisms. E. In sponges, fertilization is external and development is direct. Choose the correct answer from the options given below:

The unique mammalian characteristics are:

Match List-I with List-II. List-I (A) Contractile vacuole (B) Water vascular system (C) Canal system (D) Flame cells List-II (I) Asterias (II) Amoeba (III) Spongilla (IV) Taenia Choose the correct answer from the options given below:

Radial symmetry is NOT found in adults of phylum _______.

Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of dorsal heart. E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below:

Which one of the following statements is correct ?

Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs. B. Basophils secrete histamine, serotonin and heparin. C. Basophils are involved in inflammatory response. D. Basophils have kidney shaped nucleus. E. Basophils are agranulocytes. Choose the correct answer:

Match List I with List II: List I A. P-wave B. Q-wave C. QRS complex D. T-wave List II I. Beginning of systole II. Repolarisation of ventricles III. Depolarisation of atria IV. Depolarisation of ventricles Choose the correct answer from the options given below:

Match List-I with List-II List-I (ECG) (A) P-wave (B) QRS complex (C) T wave (D) End of T wave List-II (Electrical activity of heart) (I) Depolarisation of ventricles (II) End of systole (III) Depolarisation of atria (IV) Repolarisation of ventricles Choose the correct answer from the options given below :

Match List - I with List - II. List - I (A) Eosinophils (B) Lymphocytes (C) Neutrophils (D) Monocytes List - II (I) 6 - 8% (II) 2 - 3% (III) 20 - 25% (IV) 60 - 65% Choose the correct answer from the options given below :

Fatty acids are connected with the respiratory pathway through:

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: ATP is used at two steps in glycolysis. Reason R: First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1,6-diphosphate. In the light of the above statements, choose the correct answer from the options given below:

How many times decarboxylation occurs during each TCA cycle?

Match List I with List II: List I A. Oxidative decarboxylation B. Glycolysis C. Oxidative phosphorylation D. Tricarboxylic acid cycle List II I. Citrate synthase II. Pyruvate dehydrogenase III. Electron transport system IV. EMP pathway Choose the correct answer from the options given below:

Which of the following combinations is required for chemiosmosis?

Axile placentation is observed in (NEET 2023 (Phase 1))

In a pea flower, five petals are arranged in a specialized manner with one posterior, two lateral and two anterior. These are named as ________. ________ and ________ respectively. (NEET 2023 (Phase 2))

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae. (NEET 2023 (Phase 1))

Match the following : Type of flower -- Example (A) Zygomorphic -- (I) Mustard (B) Hypogynous -- (II) Plum (C) Perigynous -- (III) Cassia (D) Epigynous -- (IV) Cucumber Select the correct option : (NEET 2023 (Phase 2))

In Calotropis, aestivation is : (NEET 2023 (Phase 2))

Given below are two statements: Statement I: Goblet cells are unicellular glands. Statement II: Earwax is the secretion of exocrine gland. In the light of the above statements, choose the correct answer from the options given below:

Match List I and List II. List I A. Mast cells B. Inner surface of bronchiole C. Blood D. Tubular parts of nephron List II I. Ciliated epithelium II. Areolar connective tissue III. Cuboidal epithelium IV. Specialised connective tissue Choose the correct answer from the options given below:

Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below:

Match List-I with List-II. List-I (A) Columnar epithelium (B) Ciliated epithelium (C) Squamous epithelium (D) Cuboidal epithelium List-II (I) Ducts of glands (II) Inner lining of stomach and intestine (III) Inner lining of bronchioles (IV) Endothelium Choose the correct answer from the options given below:

Given below are two statements: Assertion (A): A person goes to high altitude and experiences “Altitude Sickness” with symptoms like breathing difficulty and heart palpitations. Reason (R): Due to low atmospheric pressure at high altitude, the body does not get sufficient oxygen. In the light of the above statements, choose the correct answer from the options given below:

Assertion (A): A person goes to high altitude and experiences 'altitude sickness' with symptoms like breathing difficulty and heart palpitations. Reason (R): Due to low atmospheric pressure at high altitude, the body does not get sufficient oxygen. In the light of the above statements, choose the correct answer from the options given below:

Vital capacity of lung is _______.

Select the sequence of steps in Respiration. A. Diffusion of gases (O2 and CO2) across alveolar membrane. B. Diffusion of O2 and CO2 between blood and tissues. C. Transport of gases by the blood. D. Pulmonary ventilation by which atmospheric air is drawn in and CO2 rich alveolar air is released out. E. Utilisation of O2 by the cells for catabolic reactions and resultant release of CO2. Choose the correct answer from the options given below:

Given below are two statements: Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II: Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below:

The transverse section of a plant part showed polyarch, radial and exarch xylem, with endodermis and pericycle. The plant part is identified as :

Consider the following plant tissues. Identify the lateral meristems among the above. Statements: (A) Axillary buds (B) Fascicular vascular cambium (C) Interfascicular cambium (D) Cork cambium (E) Intercalary meristem Choose the correct answer:

Which of the following statements is not correct?

Brainstem of human brain consists of:

The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :

Match List-I with List-II. List-I: (A) Palm bones (B) Wrist bones (C) Ankle bones (D) Digit bones List-II: (I) Phalanges (II) Metacarpals (III) Carpals (IV) Tarsals Choose the correct answer from the options given below:

Match List I with List II: List I (Type of Joint) A. Cartilaginous Joint B. Ball and Socket Joint C. Fibrous Joint D. Saddle Joint List II (Found between) I. Between flat skull bones II. Between adjacent vertebrae in vertebral column III. Between carpal and metacarpal of thumb IV. Between Humerus and Pectoral Girdle Choose the correct answer from the options given below:

Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:

Which of the following statements is correct

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:

'X' and 'Y' are the components of Binomial nomenclature. This naming system was proposed by 'Z': (NEET-2023 Phase-2)

Expressed Sequence Tags (ESTs) refers to :

Expressed Sequence Tags (ESTs) refers to

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

The last chromosome sequenced in Human Genome Project was :

Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: Statement I: The codon 'AUG' codes for methionine and phenylalanine. Statement II: 'AAA' and 'AAG' both codons code for the amino acid lysine. In the light of the above statements, choose the correct answer from the options given below:

Among eukaryotes, replication of DNA takes place in

Unequivocal proof that DNA is the genetic material was first proposed by

Which scientist conducted an experiment with 32P and 35S labelled phages for demonstrating that DNA is the genetic material?

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?

Given below are two statements : Statement I : The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Statement II : A transcription unit in DNA is defined primarily by the three regions in the DNA, i.e., a promotor, the structural gene and a terminator. In the light of the above statements, choose the correct answer from the options given below :

Given below are two statements: Statement I: RNA being unstable, mutate at a faster rate. Statement II: RNA can directly code for synthesis of proteins, hence can easily express the characters. In the light of the above statements, choose the correct answer from the options given below:

How many different proteins does the ribosome consist of?

The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific (D) The code is nearly universal Choose the most appropriate answer from the options given below :

A certain plant homozygous for yellow seeds and red flowers was crossed with a plant homozygous for green seeds and white flowers. The F1 plants had yellow seeds and pink flowers. The F1 plants were selfed to get F2 progeny. Assuming independent assortment of the two characters, how many phenotypic categories are expected for these characters in the F2 generation?

Select the correct statement/s with respect to mechanism of sex determination in Grasshopper. A. It is an example of female heterogamety. B. Male produces two different types of gametes either with or without X chromosome. C. Total number of chromosomes (autosomes and sex chromosomes) is same in both males and females. D. All eggs bear an additional X chromosome besides the autosomes. Choose the correct answer from the options given below:

The phenomenon of pleiotropism refers to

In which disorder change of single base pair in the gene for beta globin chain results in change of glutamic acid to valine?

Which of the following symbols represents mating between relatives in human pedigree analysis?

A heterozygous pea plant with violet flowers was crossed with a homozygous pea plant with white flowers. Violet is dominant over white. Which one of the following represents the expected combinations among 40 progenies formed?

Select the correct statements about sickle cell anaemia. A. There is a change in gene for beta globin. B. In the beta globin, there is valine in the place of Lysine. C. It is an example of point mutation. D. In the normal gene U is replaced by A. Choose the correct answer from the options given below:

Match List-I with List-II. List-I (Type of cross): A. Monohybrid Cross B. Dihybrid Cross C. Incomplete dominance D. Test Cross List-II (Phenotypic ratio): I. 1 : 1 II. 1 : 2 : 1 III. 3 : 1 IV. 9 : 3 : 3 : 1 Choose the correct answer from the options given below:

Frequency of recombination between gene pairs on some chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

Broad palm with single palm crease is visible in a person suffering from

Which of the following statements are correct about Klinefelter's Syndrome? A. This disorder was first described by Landon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below:

Match List I with List II: List I (Interaction) A. Mutualism B. Commensalism C. Amensalism D. Parasitism List II (Effect on Species A and B) I. + (A), 0 (B) II. – (A), 0 (B) III. + (A), – (B) IV. + (A), + (B) Choose the correct answer from the options given below: (NEET 2023 (Phase 1))

Given below are two statements: Statement I: Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and the competitively inferior one will be eliminated eventually. Statement II: In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below: (NEET 2023 (Phase 1))

Match List I with List II: List I (Interacting species) A. A Leopard and a Lion in a forest/grassland B. A Cuckoo laying egg in a Crow's nest C. Fungi and root of a higher plant in Mycorrhizae D. A cattle egret and a Cattle in a field List II (Name of Interaction) I. Competition II. Brood parasitism III. Mutualism IV. Commensalism Choose the correct answer from the options given below: (NEET 2023 (Phase 1))

Match List I with List II: List I A. Logistic growth B. Exponential growth C. Expanding age pyramid D. Stable age pyramid List II I. Unlimited resource availability condition II. Limited resource availability condition III. The percent individuals of pre-reproductive age is largest, followed by reproductive and post-reproductive age groups IV. The percent individuals of pre-reproductive and reproductive age groups are same Choose the correct answer from the options given below: (NEET 2023 (Phase 1))

Plants offer rewards to animals in the form of pollen and nectar and the animals facilitate the pollination process. This is an example of : (NEET 2023 (Phase 2))

For chemical defence against herbivores, Calotropis has (NEET 2023 (Phase 2))

If there are 250 snails in a pond, and within a year their number increases to 2500 by reproduction. What should be their birth rate per snail per year? (NEET 2023 (Phase 2))

Carnivorous animals - lions and leopards, occupy the same niche but lions predate mostly larger animals and leopards take smaller ones. This mechanism of competition is referred to as - (NEET 2023 (Odisha))

Between which among the following, the relationship is not an example of commensalism? (NEET 2023 (Odisha))

Given below are two statements: Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely. Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting. In the light of the above statements, choose the correct answer from the options given below: (NEET 2024)

During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out

Match List-I with List-II. List-I List-II (A) Kanamycin (I) Delivers genes into animal cells (B) ClaI (II) Selectable marker (C) Disarmed retroviruses (III) Restriction site (D) Kanamycin R gene (IV) Antibiotic resistance Choose the correct answer from the options given below.

Which of the following is not a cloning vector?

Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell. B. Cutting of DNA at specific location by restriction enzyme. C. Isolation of desired DNA fragment. D. Amplification of gene of interest using PCR. Choose the correct answer from the options given below:

Which of the following can act as molecular scissors?

Which of the following statement is incorrect about Agrobacterium tumifaciens?

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

Thermostable DNA polymerase used in PCR was isolated from :

Given below are two statements: Assertion (A): Cells of the tapetum possess dense cytoplasm and generally have more than one nucleus. Reason (R): Presence of more than one nucleus in the tapetum increases the efficiency of nourishing the developing microspore mother cells. In the light of the above statements, choose the correct answer: (NEET 2025)

In angiosperms the correct sequence of events in formation of female gametophyte in the ovule is (A) 3 successive free nuclear divisions in functional megaspores. (B) Degeneration of 3 megaspores. (C) Meiotic division in megaspore mother cell. (D) Migration of 3 nuclei towards each pole. (E) Formation of wall resulting in seven celled embryo sac. Choose the correct answer from the options given below. (NEET 2023 Phase-2)

What is the function of tassels in the corn cob?

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A: A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R: Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves. In the light of the above statements, choose the correct answer from the options given below: (NEET 2023)

Large, colourful, fragrant flowers with nectar are seen in:

Transfer of pollen grains from anther to stigma of another flower of same plant is known as:

In which of the following sets of families, the pollen grains are viable for months?

In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are: (NEET 2023)

Which of the following statements are correct? (A) Reproductive health refers to total well-being in all aspects of reproduction. (B) Amniocentesis is legally banned for sex determination in India. (C) "Saheli" - a new oral contraceptive for females was developed in collaboration with ICMR (New Delhi). (D) Amniocentesis is used to determine genetic disorders and survivability of foetus. (NEET 2023 Phase-2)

Match List I with List II: List I A. Vasectomy B. Coitus interruptus C. Cervical caps D. Saheli List II I. Oral method II. Barrier method III. Surgical method IV. Natural method Choose the correct answer from the options given below: (NEET 2023)

Which of the following sexually transmitted infections are completely curable?

Given below are two statements: Statement I: Intra Cytoplasmic Sperm Injection (ICSI) is another specialised procedure of in-vivo fertilisation. Statement II: Infertility cases due to inability of the male partner to inseminate female can be corrected by artificial insemination (AI). In the light of the above statements, choose the correct answer from the options given below: (NEET 2023 Phase-2)

Match List-I with List-II: List-I (A) Non-medicated IUDs (B) Copper releasing IUDs (C) Hormone releasing IUDs (D) Vaults List-II (i) Multiload 375 (ii) Rubber barrier (iii) Lippes loop (iv) LNG-20 Choose the correct answer from the options given below: (NEET 2023 Phase-2)

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care programme. Reason R: Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below: (NEET 2023)

Which of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

Match List I with List II: List I A. Ringworm B. Filariasis C. Malaria D. Pneumonia List II I. Haemophilus influenzae II. Trichophyton III. Wuchereria bancrofti IV. Plasmodium vivax Choose the correct answer from the options given below:

Match List I with List II: List I A. Heroin B. Marijuana C. Cocaine D. Morphine List II I. Effect on cardiovascular system II. Slow down body function III. Painkiller IV. Interfere with transport of dopamine Choose the correct answer from the options given below:

In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

Diacetyl morphine is also called as:

Match List - I with List - II. List - I (A) Typhoid (B) Elephantiasis (C) Ringworm (D) Malaria List - II (I) Protozoan (II) Salmonella (III) Aschelminthes (IV) Microsporum Choose the correct answer from the options given below :

Match List-I with List-II. List-I (A) Cytokine barriers (B) Cellular barriers (C) Physiological barriers (D) Physical barriers List-II (I) Mucus coating of respiratory tract (II) Interferons (III) Neutrophils and Macrophages (IV) Tears and Saliva Choose the correct answer from the options given below :

Which of the following statements is not correct?

In the equation GPP − R − NPP, GPP is Gross Primary Productivity, NPP is Net Primary Productivity, R here is ______.

Identify the correct statements: A. Detritivores perform fragmentation. B. The humus is further degraded by some microbes during mineralisation. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below:

The amount of nutrients such as carbon, nitrogen, potassium and calcium present in the soil at any given time is referred to as :

(Out of current syllabus — rationalised out of NCERT; included as it was asked in earlier NEET papers) Match List-I with List-II: List-I (A) Hydrarch succession (B) Xerarch succession (C) Ecological succession (D) Secondary succession List-II (I) Gradual change in the species composition (II) Faster and climax reached quickly (III) Lichens to mesic conditions (IV) Phytoplankton to mesic conditions Choose the correct answer from the options given below:

Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic, menstruation extends between menarche and menopause. Choose the most appropriate answer from the options given below: (NEET 2023)

Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below: (NEET 2023)

Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below: (NEET 2023)

Given below are two statements regarding oogenesis. Statement I : The primary follicles get surrounded by more layers of granulosa cells, a theca and shows fluid filled cavity antrum. Now it is called secondary follicle. Statement II : Graafian follicle ruptures to release the secondary oocyte from the ovary by the process called ovulation. In the light of the above statements, choose the correct answer from the options given below: (NEET 2023 Phase-2)

Which of the following is correctly matched?

In 'rivet popper hypothesis', Paul Ehrlich compared the rivets in an airplane to

Which of the following is/are cause(s) of biodiversity losses?

Among 'The Evil Quartet' which one is considered the most important cause driving extinction of species? (NEET 2023)

Which of the following statements is not correct?

Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment? (NEET 2023)

Select incorrect statement, regarding chemical structure of insulin. (NEET 2023 (Phase 2))

Match List - I with List - II. List - I (A) Gene therapy (B) RNA interference (C) ELISA (D) Gel Electrophoresis List - II (I) Separation of DNA fragments (II) Diagnostic test for AIDS (III) Cellular defence (IV) Allows correction of a gene defect Choose the correct answer from the options given below : (NEET 2023 (Phase 2))

Which of the following statements is not true ?

Identify the fossil of man who showed the following characteristics. (A) Brain capacity of 1400 cc (B) Used hides to protect their body (C) Buried their dead bodies In the light of above statements, choose the correct answer from the options given below:

Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.