NEET 2024 Biology Questions

Which of the following is an example of a zygomorphic flower? (NEET 2025)

Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b). (NEET 2024)

Identify the part of seed from the given figure which is destined to form root when the seed germinates.

Which of the following is an example of actinomorphic flower? (NEET 2024)

Match List I with List II. List I (A. Rose, B. Pea, C. Cotton, D. Mango) List II (I. Twisted aestivation, II. Perigynous flower, III. Drupe, IV. Marginal placentation) Choose the correct answer from the options given below. (NEET 2024)

Match List I with List II. List I (Types of Stamens) (A. Monadelphous, B. Diadelphous, C. Polyadelphous, D. Epiphyllous) List II (Example) (I. Citrus, II. Pea, III. Lily, IV. China-rose) Choose the correct answer from the options given below. (NEET 2024)

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of

Match list I with list II. List I: A. GLUT-4; B. Insulin; C. Trypsin; D. Collagen List II: I. Hormone; II. Enzyme; III. Intercellular ground substance; IV. Enables glucose transport into cells Choose the correct answer from the options given below.

Regarding catalytic cycle of an enzyme action, select the correct sequential steps: A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release of products. D. Chemical bonds of the substrate broken. E. Substrate binding to active site. Choose the correct answer from the options given below:

Lecithin, a small molecular weight organic compound found in living tissues, is an example of

The cofactor of the enzyme carboxypeptidase is

Match List I with List II: List I: A. Lipase; B. Nuclease; C. Protease; D. Amylase List II: I. Peptide bond; II. Ester bond; III. Glycosidic bond; IV. Phosphodiester bond Choose the correct answer from the options given below:

The following are the statements about non-chordates: A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous system is dorsal. D. Heart is dorsal if present. E. Post anal tail is absent. Choose the most appropriate answer from the options given below:

Match List I with List II: List I A. Pterophyllum B. Myxine C. Pristis D. Exocoetus List II I. Hag fish II. Saw fish III. Angel fish IV. Flying fish Choose the correct answer from the options given below:

Match List I with List II: List I A. Pleurobrachia B. Radula C. Stomochord D. Air bladder List II I. Mollusca II. Ctenophora III. Osteichthyes IV. Hemichordata Choose the correct answer from the options given below:

Consider the following statements: A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D. Platyhelminthes are pseudocoelomates Choose the correct answer from the options given below:

Match List I with List II: List I A. Axoneme B. Cartwheel pattern C. Crista D. Satellite List II I. Centriole II. Cilia and flagella III. Chromosome IV. Mitochondria Choose the correct answer from the options given below:

The DNA present in chloroplast is

Given below are two statements : Statement I : Mitochondria and chloroplasts are both double membrane bound organelles. Statement II : Inner membrane of Mitochondria is relatively less permeable, as compared to chloroplast. In the light of the above statements. choose the correct answer from the options given below :

Match list I with list II. List I A. Nucleolus B. Centriole C. Leucoplasts D. Golgi apparatus List II I. Site of formation of glycolipid II. Organisation like the cartwheel III. Site for active ribosomal RNA synthesis IV. For storing nutrients Choose the correct answer from the options given below.

Formation of interfascicular cambium from fully developed parenchyma cells is an example for

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

The capacity to generate a whole plant from any cell of the plant is called

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

Following are the stages of cell division: A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below:

Given below are two statements. Statement 1: Chromosomes become gradually visible under light microscope during leptotene stage. Statement 2: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex. In the light of the above statements, choose the correct answer from the options given below.

Match List-I with List-II: List-I (Sub Phases of Prophase I) A. Diakinesis B. Pachytene C. Zygotene D. Leptotene List-II (Specific characters) I. Synaptonemal complex formation II. Completion of terminalisation of chiasmata III. Chromosomes look like thin threads IV. Appearance of recombination nodules Choose the correct answer from the options given below:

Spindle fibres attach to kinetochores of chromosomes during

How many molecules of ATP and NADPH are required for every molecule of CO2 fixed in the Calvin cycle

Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO2 D. ATP E. NADPH Choose the correct answer from the options given below:

Given below are two statements. Statement 1: in C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased. Statement 2: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration. In the light of the above statements, choose the correct answer from the options given below.

Bulliform cells are responsible for

In the given figure of the stomatal apparatus, which component has thin outer walls and highly thickened inner walls?

Given below are two statements. Statements: Statement I: Parenchyma is living but collenchyma is dead tissue. Statement II: Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. In the light of the above statements, choose the correct answer from the options given below.

Following are the stages of pathway for conduction of an action potential through the heart A. AV bundle B. Purkinje fibres C. AV node D. Bundle branches E. SA node Choose the correct sequence of pathway from the options given below

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be A. IBi/IAi/ii B. IBIB/IAIA/ii C. IAIB/iIA/iBi D. IAi/IBi/IAi E. iIB/iIA/IAIB Choose the most appropriate answer from the options given below.

Match List I with List II: List I A. P Wave B. QRS complex C. T wave D. T-P gap List II I. Heart muscles are electrically silent II. Depolarisation of ventricles III. Depolarisation of atria IV. Repolarisation of ventricles Choose the correct answer from the options given below:

Match List I with List II. List I A. Exophthalmic goiter B. Acromegaly C. Cushing's syndrome D. Cretinism List II I. Excess secretion of cortisol, moon face & hyperglycemia II. Hypo-secretion of thyroid hormone and stunted growth III. Hyper secretion of thyroid hormone & protruding eye balls IV. Excessive secretion of growth hormone Choose the correct answer from the options given below

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements, choose the correct answer from the options given below:

Which of the following is not a steroid hormone?

Given below are two statements: Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes. Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption. In the light of the above statements, choose the correct answer from the options given below:

Choose the correct statement given below regarding juxta medullary nephron.

Given below are two statements: Statement I: The cerebral hemispheres are connected by a nerve tract known as corpus callosum. Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum. In the light of the above statements, choose the most appropriate answer from the options given below:

Match List I with List II: List I A. Pons B. Hypothalamus C. Medulla D. Cerebellum List II I. Provides additional space for neurons, regulates posture and balance II. Controls respiration and gastric secretions III. Connects different regions of the brain IV. Neurosecretory cells Choose the correct answer from the options given below:

Match List I with List II. List I A. Unicellular glandular epithelium B. Compound epithelium C. Multicellular glandular epithelium D. Endocrine glandular epithelium List II I. Salivary Glands II. Pancreas III. Goblet cells of alimentary canal IV. Moist surface of buccal cavity Choose the correct answer from the options given below:

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in the human body.

Match List I with List II: List I: A. Fibrous joints B. Cartilaginous joints C. Hinge D. Ball and socket joints List II: I. Adjacent vertebrae, limited movement II. Humerus and Pectoral girdle, rotational movement III. Skull, don't allow any movement IV. Knee, help in locomotion Choose the correct answer from the options given below:

Three types of muscle tissue are shown as (a), (b) and (c): (a) Long, parallel, cylindrical striated (cross-banded) fibres with peripheral nuclei. (b) Spindle-shaped (fusiform) non-striated cells tapering at both ends, each with a single central nucleus. (c) Striated, branched fibres joined end-to-end with central nuclei. Identify the correct matching pair along with their location in the human body (Name of muscle / location):

Which one of the following is not a criterion for classification of fungi?

Match List I with List II: List I A. Rhizopus B. Ustilago C. Puccinia D. Agaricus List II I. Mushroom II. Smut fungus III. Bread mould IV. Rust fungus Choose the correct answer from the options given below:

Match List I with List II: List I A. Expiratory capacity B. Functional residual capacity C. Vital capacity D. Inspiratory capacity List II I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume II. Tidal volume + Expiratory reserve volume III. Tidal volume + Inspiratory reserve volume IV. Expiratory reserve volume + Residual volume Choose the correct answer from the options given below:

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

Match List I with List II: List I A. Citric acid cycle B. Glycolysis C. Electron transport system D. Proton gradient List II I. Cytoplasm II. Mitochondrial matrix III. Intermembrane space of mitochondria IV. Inner mitochondrial membrane Choose the correct answer from the options given below:

Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is in oogamous method only. C. Stored food is in the form of carbohydrates which is either mannitol or laminarin. D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll. E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. Choose the correct answer from the options given below:

Match List I with List II: List I List II A. Common cold B. Haemozoin C. Widal test D. Allergy I. Plasmodium II. Typhoid III. Rhinoviruses IV. Dust mites Choose the correct answer from the options given below:

Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE) Choose the most appropriate answer from the options given below

Match List I with List II: List I List II A. Cocaine B. Heroin C. Morphine D. Marijuana I. Effective sedative in surgery II. Cannabis sativa III. Erythroxylum IV. Papaver somniferum Choose the correct answer from the options given below:

Match List I with List II: List I List II A. Typhoid B. Leishmaniasis C. Ringworm D. Filariasis I. Fungus II. Nematode III. Protozoa IV. Bacteria Choose the correct answer from the options given below:

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby. Reason R: Colostrum Contains several antibodies absolutely essential to develop resistance for the new-born baby. In the light of the above statements, choose the most appropriate answer from the options given below:

Given below are two statements: Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced. Statement II: Both Bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes. In the light of the above statements, choose the most appropriate answer from the options given below:

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

In a plant, black seed color (BB/bb) is dominant, over white seed color (bb). In order to find out the genotype of the black seed plant, which of the following genotype will you cross it?

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be A. IBi / IAi / ii B. IBIB / IAIA / ii C. IAIB / iIA / iBi D. IAi / IBi / IAi E. iIB / iIA / IAIB Choose the most appropriate answer from the options given below.

Match List I with List II: List I A. Down's syndrome B. α-Thalassemia C. β-Thalassemia D. Klinefelter's syndrome List II I. 11th chromosome II. 'X' chromosome III. 21st chromosome IV. 16th chromosome Choose the correct answer from the options given below:

Match List I with List II. List I A. Two or more alternative forms of a gene B. Cross of F1 progeny with homozygous recessive parent C. Cross of F1 progeny with any of the parents D. Number of chromosome sets in plant. List II I. Back cross II. Ploidy III. Allele IV. Test cross Choose the correct answer from the options given below.

Which one of the following can be explained on the basis of Mendel's law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the character appear as such in F2 generation. C. Factors occur in pairs in normal diploid plants. D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross. Choose the correct answer from the options given below:

Match List I with List II. List I: A. Frederick Griffith B. Francois Jacob & Jacque Monod C. Har Gobind Khorana D. Meselson & Stahl List II: I. Genetic code II. Semi-conservative mode of DNA replication III. Transformation IV. Lac operon Choose the correct answer from the options given below.

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end.

Which of the following statements is correct regarding the process of replication in E.coli ?

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

Match List I with List II. List I: A. RNA polymerase III B. Termination of transcription C. Splicing of Exons D. TATA box List II: I. snRNP's II. Promotor III. Rho factor IV. SnRNAs, tRNA Choose the correct answer from the options given below.

The lactose present in the growth medium of bacteria is transported to the cell by the action of:

The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting when they can he protected and given special care is called (NEET 2024)

These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation E. Migration Choose the correct option: (NEET 2024)

List of endangered species was released by

Match List I with List II. List I A. Robert May B. Alexander von Humboldt C. Paul Ehrlich D. David Tilman List II I. Species-Area relationship II. Long term ecosystem experiment using out door plots III. Global species diversity at about 7 million IV. Rivet popper hypothesis Choose the correct answer from the options given below. (NEET 2024)

Flippers of Penguins and Dolphins are examples of:

The flippers of the Penguins and Dolphins are the example of the

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below:

Which of the following factors will not affect the Hardy-Weinberg equilibrium?

Given below are two statements: Assertion (A): Cells of the tapetum possess dense cytoplasm and generally have more than one nucleus. Reason (R): Presence of more than one nucleus in the tapetum increases the efficiency of nourishing the developing microspore mother cells. In the light of the above statements, choose the correct answer: (NEET 2025)

Identify the part seed from the given figure which is destined to form root when the seed germinates.

Identify the set of correct statements: A. The flowers of Vallisneria are colorful and produce nectar. B. The flowers of waterlily are not pollinated by water. C. In most of water pollinated species, the pollen grains are protected from wetting. D. Pollen grains of some hydrophytes are long and ribbon like. E. In sumo hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options given below: (NEET 2024)

Identify the correct description about given figure.

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby. Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the new-born baby. In the light of the above statements, choose the most appropriate answer from the options given below: (NEET 2024)

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements, choose the correct answer from the options given below: (NEET 2024)

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis. (NEET 2024)

Given below are two statements: Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely. Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting. In the light of the above statements, choose the correct answer from the options given below: (NEET 2024)

The equation of Verhulst-Pearl logistic growth is dN/dt = rN[(K-N)/K]. From this equation, K indicates. (NEET 2024)

Which of the following is not a natural/traditional contraceptive method? (NEET 2024)

Match List I with List II: List I (A) Non-medicated IUD (B) Copper releasing IUD (C) Hormone releasing IUD (D) Implants List II (i) Multiload 375 (ii) Progestogens (iii) Lippes loop (iv) LNG-20 Choose the correct answer from the options given below: (NEET 2024)

Given below are two statements: Statement I: Bt toxins are insect group specific and coded by a gene cry 1Ac. Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut. In the light of the above statements, choose the correct answer from the options given below: (NEET 2024)

Match List I with List II. List I A. α-1 antitrypsin B. Cry 1Ab C. Cry 1Ac D. Enzyme replacement therapy List II I. Cotton bollworm II. ADA deficiency III. Emphysema IV. Corn borer Choose the correct answer from the options given below. (NEET 2024)

The "Ti plasmid" of Agrobacterium tumefaciens stands for

The following diagram showing restriction sites in E coli cloning vector pBR322. Find the role of 'X' and 'Y' genes:

In an ecosystem if the Net primary Productivity (NPP) of first trophic level is 100x kcal m⁻² yr⁻¹, what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

Match List I with List II. List I List II A. Clostridium butylicum I. Ethanol B. Saccharomyces cerevisiae II. Streptokinase C. Trichoderma polysporum III. Butyric acid D. Streptococcus sp. IV. Cyclosporin-A Choose the correct answer from the options given below.