Class 11 — Biology
Ligases is a class of enzymes responsible for catalysing the linking together of two compounds. Which of the following bonds is not catalysed by it? []
The cofactor of the enzyme carboxypeptidase is: []
Match List-I with List-II [] List-I A. Toxin B. Polymeric substance C. Lectin D. Drug List-II I. Gum II. Concanavalin A III. Ricin IV. Vinblastin Choose the correct answer from the options given below:
The catalytic cycle of an enzyme action is described as: [] A. Enzyme releases products B. Substrate induces enzyme to alter its shape C. The substrate binds with the active site of the enzyme. D. Enzyme-product complex is formed.
Enzymes that catalyse the removal of groups from substrates by mechanisms other than hydrolysis are []
Which of the following statements is incorrect about enzymes? []
Which of the following graphs correctly represents the effect of pH on enzyme activity? []
Match List-I with List-II [] List-I A. Collagen B. GLUT-4 C. Trypsin D. RuBisCO List-II I. Enzyme II. Most abundant enzyme in biosphere III. Most abundant protein in animal world IV. Enables glucose transport into cells Choose the correct answer:
Which of the following is not a complex polysaccharide? []
Lecithin, a small molecular weight organic compound found in living tissues, is an example of: []
Match List I with List II [] List I A. GLUT-4 B. Insulin C. Trypsin D. Collagen List II I. Hormone II. Enzyme III. Intercellular ground substance IV. Enables glucose transport into cells Choose the option with correct matches:
Regarding catalytic cycle of an enzyme action, select the correct sequential steps: [] A. Substrate enzyme complex formation B. Free enzyme ready to bind with another substrate C. Release of products D. Chemical bonds of the substrate broken E. Substrate binding to active site
Match List I with List II [] List I A. Lipase B. Nuclease C. Protease D. Amylase List II I. Peptide bond II. Ester bond III. Glycosidic bond IV. Phosphodiester bond Choose the correct option:
The following can be found as a zwitter ion: []
Which of the following graphs depicts the effect of substrate concentration on velocity of enzyme catalysed reaction? []
Match List-I with List-II: [] List-I A. Ribozyme B. Lecithin C. Glut-4 D. Vitamins List-II I. Glucose transport II. Non-proteinaceous enzyme III. Lipid IV. Coenzyme Choose the correct answer from the options given below:
Match List-I with List-II: [] List-I A. Primary structure of protein B. Secondary structure of protein C. Tertiary structure of protein D. Quaternary structure of protein List-II I. Human haemoglobin II. Disulphide bonds III. Polypeptide chain IV. Alpha helix and β sheet Choose the correct answer:
Which of the following is a nucleotide? []
Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of: []
Want more Chapter 9- Biomolecules questions?
MedicNEET has 10,000+ NEET-style Biology questions with detailed NCERT-based explanations — including long, tricky questions that actually come in the exam.
Download MedicNEET App — FreeBulliform cells are responsible for: []
Arrange the following in correct sequence starting from the periphery to the centre in a monocot root: A. Endodermis B. Pith C. Epidermis D. Pericycle E. Cortex []
Which of the following helps in maintenance of the pressure gradient in sieve tubes? []
Read the following statements and find out the correct set of statements: A. Companion cells help in maintaining the pressure gradient in the sieve tubes B. Gymnosperms lack vessels in their xylem C. The xylem vessels are devoid of cytoplasm D. Xylem fibres may be septate or aseptate E. A mature sieve element in phloem possesses cytoplasm, vacuole and nucleus []
In the given figure, which component has thin outer walls and highly thickened inner walls? []
Given below are two statements: Statement I: In collenchyma, cell walls are thickened at corners due to deposition of cellulose, hemicellulose and pectin. Statement II: Sclerenchyma consists of lignified cell walls and possesses pits. []
The given figure, with reference to the anatomy of plants, represents: []
Given below are two statements Statement I: Parenchyma is living but collenchyma is dead tissue. Statement II: Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. []
Given below are two statements: Statement I: In a dicotyledonous leaf, the adaxial epidermis generally bears more stomata than the abaxial epidermis. Statement II: In a dicotyledonous leaf, the adaxially placed palisade parenchyma is made up of elongated cells, which are arranged vertically and parallel to each other. Choose the correct answer: []
Which of the following simple tissues are commonly found in the fruit walls of nuts and pulp of pear? []
Want more Chapter 6- ANATOMY OF FLOWERING PLANTS questions?
MedicNEET has 10,000+ NEET-style Biology questions with detailed NCERT-based explanations — including long, tricky questions that actually come in the exam.
Download MedicNEET App — FreeGiven below are two statements: Statement I: Mitochondria and chloroplasts both double membranes bound organelles. Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast. Choose the correct answer: []
Cell wall formation in bacteria is facilitated by: []
Given below are two statements: Statement I: Concentrically arranged cisternae of Golgi complex are arranged near the nucleus with distinct convex cis or forming face and concave trans or maturing face. Statement II: A number of proteins are modified in the cisternae of Golgi complex before they are released from the cis face.
Match List I with List II. List-I A. Cilia B. Endoplasmic Reticulum C. Mitochondria D. Kinetochore List-II I. Spindle fibres II. Cristae III. Axoneme IV. Ribosomes []
Mesosome in a cell is a:
Match List I with List II: List I A. Metacentric chromosome B. Sub-metacentric chromosome C. Acrocentric chromosome D. Telocentric chromosome List II I. Chromosome has a terminal centromere II. Middle centromere forming two equal arms of chromosome III. Centromere is slightly away from the middle resulting in one shorter arm and one very long arm IV. Centromere is situated close to its end forming one very short and one very long arm
The DNA present in chloroplast is: []
Given below are two statements: Statement I: The Golgi cisternae are concentrically arranged near the nucleus with distinct convex cis or the forming face and concave trans or the maturing face. Statement II: The cis and trans faces of the organelle are identical and interconnected. Choose the correct answer:
Match List I with List II. List-I A. Nucleolus B. Centriole C. Leucoplasts D. Golgi apparatus List-II I. Site of formation of glycolipid II. Organization like the cartwheel III. Site of active ribosomal RNA synthesis IV. For storing nutrients []
Match List I with List II. List-I: A. Fleming B. Robert Brown C. George Palade D. Camillo Golgi List-II: I. Disc-shaped sacs near nucleus II. Chromatin III. Ribosomes IV. Nucleus []
Want more Chapter 8- Cell: The Unit of Life questions?
MedicNEET has 10,000+ NEET-style Biology questions with detailed NCERT-based explanations — including long, tricky questions that actually come in the exam.
Download MedicNEET App — FreeMatch List-I with List-II: List-I A. Metacentric chromosome B. Sub-metacentric chromosome C. Acrocentric chromosome D. Telocentric chromosome List-II I. Chromosome has a terminal centromere II. Middle centromere forming two equal arms of chromosome III. Centromere is slightly away from the middle of chromosome resulting into two unequal arms IV. Centromere is situated close to its end forming one extremely short and one very long arm Choose the correct answer: [ ]
Given below are two statements: Statement I: Failure of segregation of chromatids during cell cycle resulting in the gain or loss of whole set of chromosome in an organism is known as aneuploidy. Statement II: Failure of cytokinesis after anaphase stage of cell division results in the gain or loss of a chromosome is called polyploidy. In the light of the above statements, choose the correct answer from the options given below: [ ]
Match List I with List II: List-I: A. Diakinesis B. Pachytene C. Zygotene D. Leptotene List-II: i. Synaptonemal complex formation ii. Terminalisation of chiasmata iii. Chromosomes appear as thin threads iv. Appearance of recombination nodules []
Spindle fibers attach to kinetochores of chromosomes during: []
Following are the stages of cell division: 1. Gap 2 phase 2. Cytokinesis 3. Synthesis phase 4. Karyokinesis 5. Gap 1 phase Choose the correct sequence of stages: []
Match List-I with List-II: List-I A. Cells are metabolically active and proliferate B. DNA replication takes place C. Proteins are synthesised D. Quiescent stage with metabolically active cells List-II I. G2 phase II. G1 phase III. G0 phase IV. S phase Choose the correct answer: [ ]
Recombination between homologous chromosomes is completed by the end of: [ ]
Given below are two statements: Statement I: Chromosomes become gradually visible under light microscope during leptotene stage. Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.[] Choose the correct answer from the options given below:
Among eukaryotes, replication of DNA takes place in:[]
Want more Chapter 10- CELL CYCLE AND CELL DIVISION questions?
MedicNEET has 10,000+ NEET-style Biology questions with detailed NCERT-based explanations — including long, tricky questions that actually come in the exam.
Download MedicNEET App — FreeWhich of the following are required for the light reaction of photosynthesis? () A. CO₂ B. O₂ C. H₂O D. Chlorophyll E. Light
() How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle?
() The photochemical phase of photosynthesis includes: A. Oxygen release B. Formation of NADPH C. Use of ATP D. Water splitting E. Carboxylation
() How many molecules of ATP and NADPH are required, respectively, for fixation of every CO₂ molecule entering the Calvin cycle?
() Which one of the following products diffuses out of chloroplast during photosynthesis?
Synthesis of ATP linked to development of a proton gradient across a membrane is: ()
() Match List-I with List-II
() Given below are two statements: Statement I: In C₃ plants, some O₂ binds to RuBisCO, hence CO₂ fixation is decreased. Statement II: In C₄ plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration. In the light of the above statements, choose the correct answer:
() Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO₂ D. ATP E. NADPH
Want more Chapter 11- PHOTOSYNTHESIS IN HIGHER PLANTS questions?
MedicNEET has 10,000+ NEET-style Biology questions with detailed NCERT-based explanations — including long, tricky questions that actually come in the exam.
Download MedicNEET App — FreeClass 12 — Biology
Which of the following is not a characteristic feature of the genetic code?
Given below are two statements: Statement I: In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II: RNA polymerase associates transiently with 'Rho' factor to initiate transcription.
Given below are two statements: Statement I: In eukaryotes, there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelle. Statement II: All the three RNA polymerases in the eukaryotic nucleus have different roles.
Which of the following techniques was used to elucidate the double helix model of DNA?
Which of the following statement is correct regarding the process of replication in E.coli?
Match List-I with List-II: .
Which experimental material was used by Taylor and colleagues to prove that DNA in chromosomes replicates semiconservatively?
Which one is the correct product of DNA dependent RNA polymerase to the given template? Template strand: 3′TACATGGCAAATATCCATTCA5′
Match List I with List II: ()
The lactose present in the growth medium of bacteria is transported to the cell by the action of:
Given below are two statements: Statement I: In the lac operon, the z gene codes β-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose or galactose can also induce the lac operon.
In the lac operon, the i gene codes for:
Match List I with List II: A. Frederick Griffith B. Francois Jacob and Jacques Monod C. Har Gobind Khorana D. Meselson and Stahl List II I. Genetic code II. Semi-conservative mode of DNA replication III. Transformation IV. Lac operon
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end:
Match List I with List II: A. RNA polymerase III B. Termination of transcription C. Splicing of exons D. TATA box List II I. snRNPs II. Promoter III. Rho factor IV. snRNAs, tRNA
Want more Chapter 5- Molecular Basis of Inheritance questions?
MedicNEET has 10,000+ NEET-style Biology questions with detailed NCERT-based explanations — including long, tricky questions that actually come in the exam.
Download MedicNEET App — Free[] Given below are two statements: Statement I: Degeneration of corpus luteum in the absence of fertilisation is the cause for disintegration of endometrium. Statement II: Cyclic menstruation indicates normal reproductive phase in human females and extends between menarche and menopause.
[] Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis. GnRH → LH → (B) → Androgens → Formation of spermatids GnRH → FSH → (A) → (C) → Factors → (D)
[] Which of the following is not a steroid hormone?
[] Arrange in a proper sequence the pathway of sperms from testis to outside in human male reproductive system: A. Vas deferens B. Rete testis C. Seminiferous tubules D. Vasa efferentia E. Urethra F. Epididymis
[] Given below are two statements: Assertion (A): Breastfeeding during initial period of infant growth is recommended by doctors for bringing a healthy baby. Reason (R): Colostrum contains several antibodies absolutely essential to develop resistance for the newborn baby.
[] Match List-I with List-II relating to major features of embryonic development at different timings of pregnancy: List I (No. of weeks) A. After 4 weeks of pregnancy B. After 12 weeks of pregnancy C. After 24 weeks of pregnancy D. After 8 weeks of pregnancy List II (Major features) I. Eye-lids separate and eyelashes are formed II. Heart is formed III. Limbs and digits are developed IV. External genital organs are well developed Choose the correct answer:
[] Given below are two statements: Assertion (A): FSH acts upon ovarian follicles in female and Leydig cells in male. Reason (R): Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.
[] Match List-I with List-II: List I A. Parturition B. Placenta C. Colostrum D. Fimbriae List II I. Several antibodies for new-born babies II. Collection of ovum after ovulation III. Foetal ejection reflex IV. Secretion of the hormone hCG Choose the correct answer:
[] Assertion (A): During menstrual cycle, ovulation takes place approximately on 14th day. Reason (R): Rapid secretion of LH in the middle of menstrual cycle induces rupture of Graafian follicle and thereby the release of ovum. Choose the correct answer:
[] Given below are two statements: Statement I: The presence or absence of hymen is not a reliable indicator of virginity. Statement II: The hymen is torn during the first coitus only. Choose the correct answer:
[] Match List-I with List-II relating to human female external genitalia: List I (Structures) A. Mons pubis B. Clitoris C. Hymen D. Labia majora List II (Features) I. A fleshy fold of tissue surrounding the vaginal opening II. Fatty cushion of cells covered by skin and hair III. Tiny finger-like structure above labia minora IV. A thin membrane-like structure covering vaginal opening Choose the correct answer:
Which of the following is not a component of Fallopian tube?
Want more Chapter 2- HUMAN REPRODUCTION questions?
MedicNEET has 10,000+ NEET-style Biology questions with detailed NCERT-based explanations — including long, tricky questions that actually come in the exam.
Download MedicNEET App — FreeWhich of the following statements is incorrect? ()
Following are the steps involved in the process of PCR: () A. Denaturation B. Amplification (~1 billion times) C. Denaturation D. Treatment with Taq polymerase and deoxynucleotides E. Extension Choose the correct sequence:
The "Ti plasmid" of Agrobacterium tumefaciens stands for ()
Statement I: Restriction Endonuclease finds its specific recognition sequence and binds to the DNA. Statement II: Restriction Endonuclease cuts each of the two strands of the double helix at specific points in their sugar phosphate backbones. Choose the correct answer: ()
Which of the following is not a selectable marker of cloning vectors? ()
What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? () A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism. B. It may get integrated into the genome of the recipient. C. It may multiply and be inherited along with the host DNA. D. The alien piece of DNA is not an integral part of chromosome. E. It shows ability to replicate. Choose the correct answer from the options given below:
Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of: ()
Select the restriction endonuclease enzymes whose restriction sites are present for the tetracycline resistance (tetR) gene in the pBR322 cloning vector: ()
The following diagram shows restriction sites in E. coli cloning vector pBR322. What is the role of ‘X’ and ‘Y’ genes? ()
Identify the incorrect statement related to electrophoresis: ()
In a chromosome, there is a specific DNA sequence responsible for initiating replication. It is called: ()
Which of the following are correct about EcoRI? () A. Cut the DNA with blunt end B. Cut the DNA with sticky end C. Recognises a specific palindromic sequence where it encounters the DNA sequence 'GAATTC' D. Cut the DNA between the base G and A where it encounters the DNA sequence 'GAATTC' E. Exonuclease Choose the correct answer from the options given below:
Want more Chapter 9- Biotechnology: Principles and processes questions?
MedicNEET has 10,000+ NEET-style Biology questions with detailed NCERT-based explanations — including long, tricky questions that actually come in the exam.
Download MedicNEET App — FreeTropical regions show greatest level of species richness because: () A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification. B. Tropical environments are more seasonal. C. More solar energy is available in tropics. D. Constant environments promote niche specialization. E. Tropical environments are constant and predictable. Choose the correct answer:
The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called: ()
These are regarded as major causes of biodiversity loss: () A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation E. Migration Choose the correct option:
The regions with high levels of species richness, high degree of endemism, and a loss of 70% of the species and habitat are identified as: ()
Which one of the following is not included under in-situ conservation? ()
Cryopreservation technique is used for: ()
Match List I with List II () List – I A. Robert May B. Alexander von Humboldt C. Paul Ehrlich D. David Tilman List – II I. Species–Area relationship II. Long-term ecosystem experiment using outdoor plots III. Global species diversity at about 7 million IV. Rivet popper hypothesis
Highest annual Net Primary Productivity is observed in: ()
Given below are two statements: () Statement I: Rain forests, which used to cover more than 14% of the earth's land surface, are now reduced to 6%. Statement II: The Amazon rain forest has the greatest biodiversity on earth. Choose the correct answer from the options given below:
List of endangered species was released by ()
Identify the place(s) from the following where sacred groves are not found: ()
Want more Chapter 13- BIODIVERSITY AND CONSERVATION questions?
MedicNEET has 10,000+ NEET-style Biology questions with detailed NCERT-based explanations — including long, tricky questions that actually come in the exam.
Download MedicNEET App — Free+95 more questions from 21 chapters
Unlock all NEET 2024 Biology PYQs with detailed NCERT explanations in the MedicNEET app.